CWINV, CWINV (gene) Fragaria x ananassa

Gene Overview
Name CWINV
Gene Symbol CWINV
Type gene
Organism Fragaria x ananassa
Synonym cell wall invertase precursor
cell wall invertase
INV
Description sucrose hydrolysis
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cell wall acid invertaseCWINVFragaria x ananassagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CWINVAF000521.1-CWINV.m1Fragaria x ananassamRNA
CWINVAF000520.1-CWINV.m1Fragaria x ananassamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AF000521.1-CWINV.m1 LG4:23090885..23094405
AF000521.1
mRNA parsed from NCBI nr database AF000520.1-CWINV.m1 LG4:23090885..23093429
AF000520.1

Sequence(s):
>AF000521.1-CWINV.m11734
atgatattctctctttggcaattctgccttctttcacttttgctttcttttggtgttattgagcttcaagcttcccacca
tgtctatagcaaccttcaaactacccaacttgcttcaacacatccccaagctaaagacccttacagaactggttatcatt
tccagcctcgcaagaattggatcaatgatccaaatgggccactgatttacaagggcatttaccatcttttctatcagtac
aatcccagcagtgtagtttggggtaacattgtttgggcacattccacatccactgatctcgtcaactggattccacatga
agctgctatctacccatcaattctctccgatatcaatggctgttggtcggggtccgtcacaatccttcccagcggaaagc
cggccattttatacaccggaatcaaccccgacaaagaacaagttcaaaacttggcatttccaaaaaacctttccgaccca
tttcttagggagtgggttaaagtcccacaaaaccctctaatggctccaactcaagctaaccaaatcaatgccagctcatt
tagggatcctaccactgcttggctagggccagataagagatggaggttgatcattggaagcaaaaggaaccacaggggac
tagctatcctctacagaagcaaagatttcatgcattggactaaggctaaacatccattatattcaacgccaaaaaatggt
atgtgggaatgccctgattttttcccagtttcgaagactaagttgcttggtcttgacacatctgcaattggtccggatgt
taagcatgtactcaaagttagcttggacaacactaggaaagagtactacacaattggtacatataatgtgagcaaggata
tctatatcccagatgatggatcaattgagagtgattctggtttgagatatgattatggtaagttttatgcttcaaaaact
ttctttgacagtgctaagaaccgcagaatcttgtggggttggatcaatgagtcctcaagtgttagtggtgacatcaagaa
aggatggtctggactccaggcaattccaaggactattgtgctcgacaaatctagaaagcaattggtgcaatggcctgtag
tggagcttgagaaacttagaacaaacgaggtcaagttaccaagcactctccttaaaggaggatcacttcatgaagtcatt
ggtgtcacagcagcacaggctgatgtagatgttgcatttgagataagtgatctcaagaaagcagaagttatggatccaag
ttggactaatgcacaacttttgtgtagtaaaaagggtacctcagtgaaaggggctctaggaccatttggattgttggcat
ttgtttcaaaggatttgaaagaaaagacagcaatcttctatagaattttcaagtctcacaacaataacaacaaatatgtg
gttcttatgtgcagtgaccaaagcaggtcttccctaaacccagataatgatatgacaacttatggaacatttgtaaacgt
ggatcctcttcatgaaaaattgtcactaagaagcttgattgatcactctatagtggagagttttggtggaaaaggcaagg
agtgcataacagctagggtgtatcctacattggctgttgatggtgatacccatttatatgctttcaattatggaagtgag
agtgtcaaaatcgcaggaagtgcatggagcatgaaaactgctaaaatcaattga
back to top
>AF000520.1-CWINV.m11215
atggctccaactcaagctaaccaaatcaatgccagctcatttagggatcctaccactgcttggctagggccagataagag
atggaggttgatcattggaagcaaaaggagccaaaggggactagctatcctctacagaagcaaagatttcatgcattgga
ctaaggctaaacatccattatattcaacaccgaaaaatggtatgtgggaatgccctgattttttcccagtttcgaagact
aagttgcttggtcttgacacatctgcaattggtccggatgttaagcatgtactcaaagttagcttggacaacactaggaa
agagtactacacaattggtacatataatgtgagcaaggatatctatatcccagatgatggatcaattgagagtgattctg
gtttgagatatgattatggtaagttttatgcttcaaaaaccttctttgacagtgctaagaaccgcagaatcttgtggggt
tggatcaatgagtcctcaagtgttagtggtgacatcaagaaaggatggtctggactccaggcaattccaaggactattgt
gctcgacaaatctggaaagcaattggtgcaatggcctgtagtagagcttgagaaacttagaacaaacgaggtcaagttac
caagcactctccttaaaggaggatcacttcatgaagtcattggtgtcacagcagcacaggctgatgtagatgttgcattt
gagataagtgatctcaagaaagcagaagttatggatccaagttggactaatgcacaacttttgtgtagtaaaaagggtac
ctcagtgaaaggggctctaggaccatttggattgttggcatttgtttcaaaggatttgaaagaaaagacagcaatcttct
atagaattttcaagtctcacaacaataacaacaaatatgtggttcttatgtgcagtgagcaaagcagatcttccctaaac
ccagataatgatatgacaacttacggagtatttgtaaatgtggatcctcttcatgaaaagctgtcattaagaagtttgat
tgatcactctatagtggagagttttggtggaaaaggcaaggcgtgcataacagctagggtgtatcctacaatgactgttg
atggtgatacccatttatatgcattcaattatggaagtgagagtgtcaaaatcgcaggaagtgcatggagcatgaaaact
gctcaaatcaattga
back to top