FRK, FRK (gene) Fragaria x ananassa

Gene Overview
Name FRK
Gene Symbol FRK
Type gene
Organism Fragaria x ananassa
Synonym fructokinase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
fructokinaseFRKFragaria x ananassagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
FRKDQ641517.1-FRK.m1Fragaria x ananassamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ641517.1-FRK.m1 N/A DQ641517.1

Sequence(s):
>DQ641517.1-FRK.m1552
ttcgagggagatgttaatcgatttcgtcccaaccacgaatggactttcactggctgatgcacctgcatttaaaaaagctg
ctggaggtgcccctgcaaatgttgcagttggcatagctcgtctaggtggctcatcagcctttattgggaaggtgggggaa
gatgaatttgggtacatgcttgctgatatattaaaggagaataatgtcaacaatgaagggatgcgttttgatcctggtgc
acgaactgctttagcatttgttacattgaggagtgatagggaacgtgagttcatgttttatcgtaatcctagtgctgata
tgttgcttcaagaagctgaacttgatttagatttaataaggaaggcaaaaatattgcactatggatctataagtcttatt
acagaaccatgcaagtccacccatattgcagcagcaaaagctgcaaaggaactggtgttgttttggtcatatgatcccaa
cctcaggcttccgctgtggccttctgcaaaaagtgccagaaaaagaaattttgagtatgtgggaaactgctg
back to top