GAPDH2, GAPDH2 (gene) Fragaria x ananassa

Gene Overview
Name GAPDH2
Gene Symbol GAPDH2
Type gene
Organism Fragaria x ananassa
Synonym glyceraldehyde 3-phosphate dehydrogenase 2
glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDH2AF421493.1-GAPDH2Fragaria x ananassagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDH2AF421493.1-GAPDH2.m1Fragaria x ananassamRNA
GAPDH2AF421145.1-GAPDH2.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHFragaria x ananassagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF421493.1-GAPDH2 N/A AF421493.1
mRNA parsed from NCBI nr database AF421493.1-GAPDH2.m1 N/A AF421493.1
mRNA parsed from NCBI nr database AF421145.1-GAPDH2.m1 N/A AF421145.1

Sequence(s):
>AF421493.1-GAPDH2845
tccatcactggtgagttttcacttgtgacttgagatatatgaatgttgagatgctatatataaatctaatggaagttgat
tgtgtctttgtaattcagccacccagaagactgttgatggaccatcagccaaggactggagaggtggacgtgctgcctca
ttcaacatcattcctagcagcactggagctgccaaggtatgttatgttctctggtgttgctgctagtttcagtatcacag
atacatttccaagtgatatttcattgttagctgctttattaatccgattcctgtttgattgtcatgttcaggctgtcgga
aaggttctgcctgctctcaatggcaagttgactggaatggccttccgtgtacccactgttgatgtttcagttgttgacct
cactgtcagacttgagaagaaggccacctatgaccagatcaaggctgctatcaagtaaggctcggaaaagtttgtcggct
aaataagttgcaatcaagatgatataatgaatggtataatgcatgtcttgtttcccatgtttatgtctactctgtctcaa
cagggaggggtctgagggaaagatgaagggtatcttgggttacaccgaagatgatgttgtgtcaaccgacttcattggtg
acaacaggtaaattctattctgtttgggatttgactcaacaagttaaagccagagaacaatctgtcatgtttggacggtg
attatctatattgtagttgtgtaatatcggctttatctaattcaatatctggttctctcaggtcaagcatctttgatgcc
aaggctggaattgcattgaacgagaactttgtcaaggttgtgtca
back to top
>AF421493.1-GAPDH2.m1399
tccatcactgccacccagaagactgttgatggaccatcagccaaggactggagaggtggacgtgctgcctcattcaacat
cattcctagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggcct
tccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggccacctatgaccagatcaag
gctgctatcaaggaggggtctgagggaaagatgaagggtatcttgggttacaccgaagatgatgttgtgtcaaccgactt
cattggtgacaacaggtcaagcatctttgatgccaaggctggaattgcattgaacgagaactttgtcaaggttgtgtca
back to top
>AF421145.1-GAPDH2.m1399
tccatcactgccacccagaagactgttgatggaccatcagccaaggactggagaggtggacgtgctgcctcattcaacat
cattcctagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgacaagttgactggaatggcct
tccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggccacctatgaccagatcaag
gctgctatcaaggaggagtctgagggaaagatgaagggtatcttgggttacaccgaagatgatgttgtgtcaaccgactt
cattggtgacaacaggtcaagcatctttgatgccaaggctggaattgcattgaacgagaactttgtcaagcttgtgtca
back to top