PAL1, PAL1 (gene) Fragaria x ananassa

Gene Overview
Name PAL1
Gene Symbol PAL1
Type gene
Organism Fragaria x ananassa
Synonym phenylalanine ammonia-lyase
phenylalanine ammonia-lyase 1
FaPAL1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
phenylalanine ammonia lyasePALFragaria x ananassagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
PAL1AB360390.1-PAL1.m1Fragaria x ananassamRNA
PAL1KX450226.1-PAL1.m1Fragaria x ananassamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB360390.1-PAL1.m1 LG6:8936538..8937101
AB360390.1
mRNA parsed from NCBI nr database KX450226.1-PAL1.m1 N/A KX450226.1

Sequence(s):
>AB360390.1-PAL1.m1563
agtgctgagcagcacaaccaggatgtcaactctttggggctgatttcgtcacgaaaaactgcagaagcagttgacatact
gaagctcatgtcttccacatttttggtagcgctttgccaagccattgatttgaggcatttggaggagaacttgaagagca
cggttaagaacactgtgagtcagttggccaagaggcttttaactaccggggtgaatggagagcttcacccttcgaggttc
tgtgagaaggatttgcttatggttgtcgaaagggagtaccttttcgcctacattgacgatccttgcagcgctacatatcc
gttgatgcaaaggctaaggcaagtgcttgttgaacacgccttgacaaatggtgaaaatgagaagaacgcaaacacttcaa
ttttccaaaagatttcggcatttgaggaagagcttaagaccattttgcctaaagaggttgagagcgttagggctgcatgc
gagagcggtaatgcggcgattccaaacagaatcatcgagtgcaggtcatatcctttgtacaaatttgtgagggaggagtt
ggg
back to top
>KX450226.1-PAL1.m12157
atggcgcttaacggaaacggaaactgcaacggggcggcagcggtgggctcattttgccaaggaggaggactactacatga
cccgttgaactggaacttggcggcggaggggttgaaagggagccacctggacgagctgaaaagaatggtgaatgactacc
ggaagccggtggtgatgctgggaggggagagcctcactgtagggcaggtggcggcgattgccaaccacgacggtggcgtg
cgcgtggagctttccgaggagaagcgggctggggtgaaggccagcagtgactgggtcatggattcaatggggaagggtac
agacagttacggtgtcaccaccgggttcggtgctacctcccaccggagaaccaaaaacggtggagctctccagaaagaac
tcatcagattcttgaatgccggaatctttggcagcagcttagactctactcacaaattgcctcacaccgcaacaagggcg
gcgatgctagtaaggatcaacaccctcctccagggttactcggggattaggttcgaaatcttggaagccattaccaaact
cctcaatggtaacatcactccatgcctgccacttcggggcacgatctcgtcgtcgggtgacttggttcccctttcataca
ttgccgggcttttgatcggcaggcccaattcaaagtccattgggcctaatggcgagaccctaaccccggctgaggcgttt
aagttggccggaattgagggtgatttctttgaattgcaacccaaggaaggacttgctttggtgaatggtactgctgttgg
gtctggtatggcttctgtggtgctgtttgatgctaacactctagctgttctttccgagatcatgtcagcgattttcgctg
aagttatgcaaggaaagccggagtttacagaccacttgacacataaactgaagcaccaccctggccagattgaagctgca
gccataatggagcacattcttgatggaagctcatatgtgaaagaagcgaagaaggttcatgaaatggaccctcttcaaaa
gcctaagcaagacagatatgctctaagaacctccccacaatggctaggccccttgattgaggtgatcagatcatcaacca
aaatgattgagagggagatcaactctgtcaacgacaatccattgatcgatgtctcaaggaacaaggccttacatggtgga
aacttccaaggaaccccaattggtactgccatggacaacaccagactcgcccttgcctccattggaaaactcatatttgc
acaattttctgagcttgtcaatgacttctacaacaatggcttgccttccaacctctcaggtggtagcaacccaagtttgg
actacggcttcaaaggtgcagaaatcgcaatggcatcatactgctccgagcttcagttcctagccaaccccgtgaccaac
catgtccaaagtgctgagcaacacaaccaagatgtcaactccttgggactgatctcctctagaaaaacatccgaggctgt
cgacattttgaagctaatgtcatcaacattcctagttgcattgtgccaagctgttgatctcaggcatatggaagagaact
tgaagagcgttgtcaagaacactgtaagtaaagtggccaggaggactctcaccgttgcccctaacggtgagcttcacccc
tctcgattctcagagaaacacctgctctcagtcgtggaccgcgagtaccttttctcctacattgacgacccctgccttgc
tacctatccattgatgcaaaaactgagggcagagctagtagaacatgccttgaataatggtgacaaagagaagagcacaa
acacctccatcttcctcaagattgctgcttttgaagaggaactgaagagtgtcttgcctaaagaagtcgacaatgctagg
atggaaattgagaatgggaaagcagaaattgcaaacaggatcaaggaatgcaggtcttatccattgtacaggtttgtgag
ggaggaattggggactagtttattgactggtgagaagatcaggtcacctggagaagaatgtgacaaggtgttcaacgcaa
tctgcgctgggaagctgattgaccctctgctggagtgtctgaaggagtggaatggtgcccccctgcccatatcttag
back to top