F3H, AY965340.1-F3H.m1 (mRNA) Malus x domestica

Unique NameAY965340.1-F3H.m1
OrganismMalus x domestica (Apple)

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
F3HF3HMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AY965340.1-F3H.m1-cds1AY965340.1-F3H.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
F3HAY965340.1-F3H.p1Malus x domesticapolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
AY965340 region AY965340:1..1098+ NCBI Rosaceae gene and mRNA sequences
Chr02 chromosome Chr02:10684928..10686924- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr2 chromosome chr2:11329044..11331039+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr2 chromosome chr2:11905962..11907957- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>AY965340.1-F3H.m1 ID=AY965340.1-F3H.m1|Name=F3H|organism=Malus x domestica|type=mRNA|length=1098bp
back to top

protein sequence of F3H

>AY965340.1-F3H.p1 ID=AY965340.1-F3H.p1|Name=F3H|organism=Malus x domestica|type=polypeptide|length=365bp
back to top

mRNA from alignment at AY965340:1..1098+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AY965340.1-F3H.m1 ID=AY965340.1-F3H.m1|Name=F3H|organism=Malus x domestica|type=mRNA|length=1098bp|location=Sequence derived from alignment at AY965340:1..1098+ (Malus x domestica)
atggctcctgctactactacgctcacatccatagcgcatgagaaaaccct acaacaaaaatttgtccgagacgaagacgagcgtccaaaggttgcctaca acgacttcagcaacgaaattccgatcatctcgcttgccgggcttgatgag gtggaaggacgccggggcgagatttgcaagaagattgtagcggcttgtga ggactggggtattttccagattgttgaccatggggttgatgctgagctca tatcggaaatgaccggtctcgctagagagttctttgctttgccatctgag gagaagctccgcttcgacatgtccggtggcaaaaagggtggcttcatcgt gtccagtcatttacagggagaagctgtgcaagattggcgtgaaattgtga cctacttttcatatccgattcgtcaccgggactattcgaggtggccagac aagcctgaggcctggagggaggtgacaaagaagtacagtgacgagttgat ggggctggcatgcaagctcttgggggttttatcagaagccatggggttgg atacagaggcattgacaaaggcatgtgtggacatggaccaaaaagtcgtc gtaaatttctacccaaaatgccctcagcccgacctgacccttggcctcaa gcgccacaccgacccgggcacaattacccttctgcttcaagaccaagttg ggggcctccaggctacacgggatgatgggaaaacgtggatcaccgttcaa ccagtggaaggagcttttgtggtcaatcttggagatcatggtcatcttct gagcaatgggagggtcaagaatgctgatcaccaagcagtggtgaactcaa acagcagcaggctgtccatagccacattccagaacccagcgcaagaagca atagtgtatccactcagtgtgagggagggagagaagccgattctcgaggc gccaatcacctacaccgagatgtacaagaagaagatgagcaaggatcttg agcttgccaggctgaaaaaactgtccaaggaacagcaactgcaggacttg gagaaagccaaagtggatacaaagccagtggacgacatttttgcttag
back to top

Coding sequence (CDS) from alignment at AY965340:1..1098+

>AY965340.1-F3H.m1 ID=AY965340.1-F3H.m1|Name=F3H|organism=Malus x domestica|type=CDS|length=1098bp|location=Sequence derived from alignment at AY965340:1..1098+ (Malus x domestica)
back to top