BZIP14, BZIP14 (gene) Malus x domestica

Gene Overview
Name BZIP14
Gene Symbol BZIP14
Type gene
Organism Malus x domestica
Synonym BZIP domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BZIP14HM122466.1-BZIP14.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
BZIP domain class transcription factorBZIPMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122466.1-BZIP14.m1 Chr02:11699472..11699946
chr2:12516046..12516520
HM122466.1

Sequence(s):
>HM122466.1-BZIP14.m1474
atggcttcttcaagtggggtttcttcagagtcaagcaagctccaaaactcaggatctgatgaagatcttaaccaagtcat
ggaccagagaaagcgcaaaagaatgctgtccaaccgggaatcggcacgtcgatcccggatgcgaaaacaggagcatctga
ctgatctgacggctcagattggtctcctgacaagggataacaaccagatcatcacatccatgaacgtgaccaaccagctt
tacatgaagctcgaggcagaaaactcagtcctcagagctcagatggatgagctcacaaacagattgcagtctctcaatga
tattatggattgtattaattcaagcaaatggatctatgaggaagaagataatcataatattattggtggaggtgatgggt
ttctgaacccatggggtactggctttttgaataatcaaccaatcatggcctctgcagacatgtttatgtgctaa
back to top