BZIP8, BZIP8 (gene) Malus x domestica

Gene Overview
Name BZIP8
Gene Symbol BZIP8
Type gene
Organism Malus x domestica
Synonym BZIP domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BZIP8HM122481.1-BZIP8.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
BZIP domain class transcription factorBZIPMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM122481.1-BZIP8.m1 chr13:10499727..10501099
chr13:10772263..10773635
HM122481.1

Sequence(s):
>HM122481.1-BZIP8.m1612
atgttatccatctcctcctcctcctccagtttggagcaactacagcaagtacagcagccatctggttcttcttcctcgag
gcctcctcatccttctcttcttcttcatagtaacaccaagaacagtaacaaactagacgttccttggttttggtcattgg
atgatgatgatgatgatggtgataatgttccagaagagagcgatgaagatatgttcacggttccggacgtggaggcgttg
ccccctcctaataatagtattaataatgcggcctctacaatcgccaaagccaccagtaacaacaacaacccagatgccca
gtctggctttccggccaagcgccgccgaggccgaaatcccgtcgataaggagtacaggcgactgaagagattgctaagga
acagggtgtctgctcaacaagcccgggagaggaaaaaggtttacgtcaacgatctggaatcaagagccaaagaattggat
gataggaattcaaagttggaagaaaagatctctacgcttgtcaatgaaaacgccatgcttcgaaaggttcttatgaacac
aaggccaaaagtggacgaaagtattgagcaaaagcaaggatcagttaagtaa
back to top