BZIP8, HM122481.1-BZIP8.m1 (mRNA) Malus x domestica

Unique NameHM122481.1-BZIP8.m1
OrganismMalus x domestica (Apple)

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BZIP8BZIP8Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM122481.1-BZIP8.m1-cds1HM122481.1-BZIP8.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
BZIP8HM122481.1-BZIP8.p1Malus x domesticapolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
HM122481 region HM122481:70..681+ NCBI Rosaceae gene and mRNA sequences
chr13 chromosome chr13:10499728..10501099- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr13 chromosome chr13:10772264..10773635- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>HM122481.1-BZIP8.m1 ID=HM122481.1-BZIP8.m1|Name=BZIP8|organism=Malus x domestica|type=mRNA|length=612bp
back to top

protein sequence of BZIP8

>HM122481.1-BZIP8.p1 ID=HM122481.1-BZIP8.p1|Name=BZIP8|organism=Malus x domestica|type=polypeptide|length=203bp
back to top

mRNA from alignment at HM122481:70..681+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM122481.1-BZIP8.m1 ID=HM122481.1-BZIP8.m1|Name=BZIP8|organism=Malus x domestica|type=mRNA|length=612bp|location=Sequence derived from alignment at HM122481:70..681+ (Malus x domestica)
atgttatccatctcctcctcctcctccagtttggagcaactacagcaagt acagcagccatctggttcttcttcctcgaggcctcctcatccttctcttc ttcttcatagtaacaccaagaacagtaacaaactagacgttccttggttt tggtcattggatgatgatgatgatgatggtgataatgttccagaagagag cgatgaagatatgttcacggttccggacgtggaggcgttgccccctccta ataatagtattaataatgcggcctctacaatcgccaaagccaccagtaac aacaacaacccagatgcccagtctggctttccggccaagcgccgccgagg ccgaaatcccgtcgataaggagtacaggcgactgaagagattgctaagga acagggtgtctgctcaacaagcccgggagaggaaaaaggtttacgtcaac gatctggaatcaagagccaaagaattggatgataggaattcaaagttgga agaaaagatctctacgcttgtcaatgaaaacgccatgcttcgaaaggttc ttatgaacacaaggccaaaagtggacgaaagtattgagcaaaagcaagga tcagttaagtaa
back to top

Coding sequence (CDS) from alignment at HM122481:70..681+

>HM122481.1-BZIP8.m1 ID=HM122481.1-BZIP8.m1|Name=BZIP8|organism=Malus x domestica|type=CDS|length=612bp|location=Sequence derived from alignment at HM122481:70..681+ (Malus x domestica)
back to top