S1-RNase, HQ689387.1-S1-RNase.m1 (mRNA) Malus x domestica

Unique NameHQ689387.1-S1-RNase.m1
OrganismMalus x domestica (Apple)

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
S1-RNaseHQ689387.1-S1-RNaseMalus x domesticagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S1-RNaseS1-RNaseMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HQ689387.1-S1-RNase.m1-cds1HQ689387.1-S1-RNase.m1-cds1Malus x domesticaCDS
HQ689387.1-S1-RNase.m1-cds2HQ689387.1-S1-RNase.m1-cds2Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
S1-RNaseHQ689387.1-S1-RNase.p1Malus x domesticapolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
HQ689387 region HQ689387:1..540+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>HQ689387.1-S1-RNase.m1 ID=HQ689387.1-S1-RNase.m1|Name=S1-RNase|organism=Malus x domestica|type=mRNA|length=196bp
back to top

protein sequence of S1-RNase

>HQ689387.1-S1-RNase.p1 ID=HQ689387.1-S1-RNase.p1|Name=S1-RNase|organism=Malus x domestica|type=polypeptide|length=65bp
back to top

mRNA from alignment at HQ689387:1..540+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HQ689387.1-S1-RNase.m1 ID=HQ689387.1-S1-RNase.m1|Name=S1-RNase|organism=Malus x domestica|type=mRNA|length=540bp|location=Sequence derived from alignment at HQ689387:1..540+ (Malus x domestica)
ttttacgcagcaatatcagccggctgtctgcaactctaatccaactcctt gtaaggatcctcctgacaagttgtttaccgttcacggtttgtggccttca aactcgaatggaaatgacccagaatattgcaaggcaccgccatatcatac ggtaatattattagcataatcagatagtcaatattatttctctcatttat gtacttgtgtgtgtgtatatatatatttttggataatgctaaagtcacca agtttttaaaccaaattatgtgtcacagtagaaaataaacacgttaatca acacttaaataataattcaatcatcaacatccacatcattttattacaaa aaagtttgtcttcctagcattactctatattttttttatatatacatata ctcaacacaggttttcatgcaggcgtgtagaaatattacaattaatttaa aatttaatcataaattatttctattatatattattatattgtcagataaa aatgctcgaaccccagttggtaatgatttggccgaacgta
back to top

Coding sequence (CDS) from alignment at HQ689387:1..540+

>HQ689387.1-S1-RNase.m1 ID=HQ689387.1-S1-RNase.m1|Name=S1-RNase|organism=Malus x domestica|type=CDS|length=196bp|location=Sequence derived from alignment at HQ689387:1..540+ (Malus x domestica)
back to top