HSF1, HSF1 (gene) Malus x domestica

Gene Overview
Name HSF1
Gene Symbol HSF1
Type gene
Organism Malus x domestica
Synonym HSF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
HSF1HM122597.1-HSF1.m1Malus x domesticamRNA
HSF1HM122589.1-HSF1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Heat shock factorHSFMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122597.1-HSF1.m1 Chr14:8530890..8534517
chr14:10991253..10994877
HM122597.1
predicted genes from whole genome assembly HM122589.1-HSF1.m1 Chr16:1246391..1248406
chr10:1456138..1458153
chr10:1789382..1791397
HM122589.1

Sequence(s):
>HM122597.1-HSF1.m1648
atgctggtggaggatccggcgacggacgatgtgatatcctggaacgacgatgggtcggcgttcgtggtgtggcagacggc
ggaatttgcccgggatctcctcccaacactcttcaagcatagtaacttctctagctttgtcaggcagctaaatacttatg
gatttcgcaaagttgccacaaacaggtgggagttctgcaacgacaagttccgaaagggcgaaaaggatcagctatgtgac
atccgtagaagaaaagcatgggccaccaaacaacagccgatcaacaatgcagtaacccaacaagctggagcagctgcact
actaccaaatgagtttgatgaagaccaaaggtcctcctcaacttcatcatcatccgagttcagctctctcgtcgacgaaa
acaaaaggctgaagcaggagaacggggttttgagctcggagctgacgagcatgaaacggaagtgcaaggagcttcttgac
ttggtggcaaagtatggagactcggctgagaaagaggaggaagataatgaaagagtgctaaagttgtttggagtgagatt
ggaggttactggagagagggagaggaagagaaagagagctgaaattagtgcaaccgcaaacgttttactatctcaagcat
gcaaataa
back to top
>HM122589.1-HSF1.m11245
atggtgaaatcggcggagaagggcggaggagatgggtctgggccgtcggggtcggtgcctccttttctcagaaaatgcta
cgagatggtggatgacaaggacagcgacagtataatctcgtggagtgaagccggcgacagctttgcgatactggacatgg
cccagttctcgatttcaatgctgcccaagtatttcaagcacagcaacttttctagcttcatgaggcagctcaatatctat
ggatttagaaaaatagatccagatcgttgggtgtttgcaaatgaaggatttattcgaggtcaaaagcatttgttgaagaa
tattgctagaaggaaacatccacagggcacagatcaaaaaaagatattacagcaaaaagacaatcctgatataccgtctg
aaaatattagtgaaaatggtctgtggaaggaagttgagaacttgaagactgataaagttgctctgaagcaagagttggtg
aagcttaggcagcaccaggaaatttcacaaaataaattgctcctcctgaggaaccgccttcgcggaatggagaaaaatca
acagcagatgctgtcatttctagtgatggccatgcaaagtcctggatttctagttcagcttcttcatccaaaggaaaata
gttggcgaattgctgaagctggcaatataatagaacagtgtatggatgatgatagaccagtggcttctgatggtgcgata
gtgaggtaccaaccaccgatgattgaagccccaaagcctttagtcccaccgaattcaggctcagagaaacaacctgaagt
tgatgcttatatggatggaatggaagattttgttgtaaatcctgatttcatgaaaatgctaatggatgaaaagttgagcc
ctgtagaaacccatgccccatatactctaccagatatatctgacgatggtgcatgggagcagtttcttttagctagtcct
ttcttagaaaatattgaaggtacaaaggaagatggcgaagagcctgctgatgctagaatggaggtggaaccaatagtatc
tgatctggatgaatcacaaaattttgattatttagtcgagcaaatgaagaaatctcagaactttgcatcggattcaacag
ttgatggatctaatatggagagctctcaaaacttggagtttattactgaacaaatgggacatttggcttctgactctaac
aacatggaacagaatcagggaagcagaaggacaacttctgtgtaa
back to top