IAA8A, IAA8A (gene) Malus x domestica

Gene Overview
Name IAA8A
Gene Symbol IAA8A
Type gene
Organism Malus x domestica
Synonym AUX/IAA8A
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IAA8ADQ848599.1-IAA8A.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Indole acetic acid-induced proteinIAAMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly DQ848599.1-IAA8A.m1 Chr01:14635995..14638172
chr1:7408511..7410706
DQ848599.1

Sequence(s):
>DQ848599.1-IAA8A.m1456
ggatggcctccggttagatcatttaggaagaattctctagccactacatcaaagaacaatgatgaagtgaatggaaaacc
tggtcccggtggactttttgtcaaggtcagcatggatggggctccctacctgaggaaggtagacctgagaacctactcta
catatcaagatctgtcttctgctctggaaaagatgttcagctgttttaccatagggcaatacgggtcccatggagctccg
gggagggaaagactgagtgagagtaagctgagagatcttcttcacggatcagaatatgttcttacatatgaggacaagga
tggtgactggatgcttgttggggatgtcccatgggagatgtttattgacacatgcaagaggttgaagataatgaagggct
ccgatgccattggtttagctcctagggccatggagaaatccaagaaccggaactag
back to top