Si-RNase, Si-RNase (gene) Prunus dulcis

Gene Overview
Name Si-RNase
Gene Symbol Si-RNase
Type gene
Organism Prunus dulcis
Synonym Si-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Si-RNaseAF267512.1-Si-RNase.m1Prunus dulcismRNA
Si-RNaseDQ059314.1-Si-RNase.m1Prunus dulcismRNA
Si-RNaseDQ058402.1-Si-RNase.m1Prunus dulcismRNA
Si-RNaseDQ058401.1-Si-RNase.m1Prunus dulcismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus dulcisgene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AF267512.1-Si-RNase.m1 N/A AF267512.1
mRNA parsed from NCBI nr database DQ059314.1-Si-RNase.m1 N/A DQ059314.1
mRNA parsed from NCBI nr database DQ058402.1-Si-RNase.m1 N/A DQ058402.1
mRNA parsed from NCBI nr database DQ058401.1-Si-RNase.m1 N/A DQ058401.1

Sequence(s):
>AF267512.1-Si-RNase.m1495
cagttcgttcaacagtggccaccgaccaactgcagagttcgcatcaaacgaccttgccccaatccccgaccattacaata
tttcaccatccatggcctatggccaagtaattattcaaacccaacgaagcccagtaaatgcactggtccgaaatttgatg
caaggaaagtgtctcctaaaatgcgaatcaaactgaagatatcttggccagacgtggaaagtggcaatgatacaagattt
tgggaaggagaatggaacaaacatggtacatgttcccgagagagacttaaccaaatgcaatacttcgagcgatcgcacga
catgtggttgtcgtacaatattacagagatccttaaaaacgcttcaatcgtaccaaatgcaactcaaaagtggagctact
cggacataatatcacccattaaagcagcaactggaagcacacccctccttcgttgcaaacaggctaagaatactcagttg
ttacatgaagtggta
back to top
>DQ059314.1-Si-RNase.m1596
gcgatgttgaaatcgtcactcggtttccttgttcttgcttttgctttcttcatgtgtttcattatgtgcactggatctta
tgtctattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaaacctcggc
cactacaaaatttcaccatccatggcctttggccaagtaattattcaaacccaacgaagcccagtaattgcaatggggca
aaatatgaggacaggaaagtgtaccctaaattgcgatccaaactcaagagatcttggcccgacgtggaaagtggcaatga
tacaagattttgggaaggcgaatggaacaaacatggcagatgttccgaacagacacttaaccaaatgcaatacttcgagg
tatcccatgacatgtggctgtcgtacaatattactgagatcctaagaaacgcttcaatcgtaccacatccgacacaaaca
tggacctactcggacatagtatcacccattaaagcagcaactaaacgaacacccctcattcgttgcaaaattgatacagc
aactaatactgagttgttacatgaagtggtattttg
back to top
>DQ058402.1-Si-RNase.m1596
cgggcgatgttgaaatcgtcactcggtttccttgttcttgcttttgctttcttcatgtgtttcattatgtgcactggatc
ttatgtctattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaaacctc
ggccactacaaaatttcaccatccatggcctttggccaagtaattattcaaacccaacgaagcccagtaattgcaatggg
gcaaaatatgaggacaggaaagtccctaaattgcgatccaaactcaagagatcttggcccgacgtggaaagtggcaatga
tacaagattttgggaaggcgaatggaacaaacatggcagatgttccgaacagacacttaaccaaatgcaatacttcgagg
tatcccatgacatgtggctgtcgtacaatattactgagatcctaagaaacgcttcaatcgtaccacatccgacacaaaca
tggacctactcggacatagtatcacccattaaagcagcaactaaacgaacacccctcattcgttgcaaaattgatacagc
aactaatactgagttgttacatgaagtggtattttg
back to top
>DQ058401.1-Si-RNase.m1596
gcgatgttgaaatcgtcactcggtttccttgttcttgcttttgctttcttcatgtgtttcattatgtgcactggatctta
tgtctattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaaacctcggc
cactacaaaatttcaccatccatggcctttggccaagtaattattcaaacccaacgaagcccagtaattgcaatggggca
aaatatgaggacaggaaagtgtaccctaaattgcgatccaaactcaagagatcttggcccgacgtggaaagtggcaatga
tacaagattttgggaaggcgaatggaacaaacatggcagatgttccgaacagacacttaaccaaatgcaatacttcgagg
tatcccatgacatgtggctgtcgtacaatattactgagatcctaagaaacgcttcaatcgtaccacatccgacacaaaca
tggacctactcggacatagtatcacccattaaagcagcaactaaacgaacacccctcattcgttgcaaaattgatacagc
aactaatactgagttgttacatgaagtggtattttg
back to top