GLU, GLU (gene) Prunus persica

Gene Overview
Name GLU
Gene Symbol GLU
Type gene
Organism Prunus persica
Synonym beta-1,3-glucanase
Gns1
Gns2
Gns3
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GLUU49454.1-GLUPrunus persicagene
GLUAF435089.1-GLUPrunus persicagene
GLUAF435088.1-GLUPrunus persicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GLUU49454.1-GLU.m1Prunus persicamRNA
GLUAF435089.1-GLU.m1Prunus persicamRNA
GLUAF435088.1-GLU.m1Prunus persicamRNA
GLUAJ002748.1-GLU.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
beta-1,3-glucanaseGLUPrunus persicagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database U49454.1-GLU scaffold_7:8592335..8593548
scaffold_7:8581254..8582563
U49454.1
gene parsed from NCBI nr database AF435089.1-GLU scaffold_7:8584000..8585698
AF435089.1
gene parsed from NCBI nr database AF435088.1-GLU scaffold_7:8581254..8582563
scaffold_7:8592335..8593548
AF435088.1
mRNA parsed from NCBI nr database U49454.1-GLU.m1 scaffold_7:8592335..8593548
scaffold_7:8581254..8582563
U49454.1
mRNA parsed from NCBI nr database AF435089.1-GLU.m1 scaffold_7:8584000..8585698
AF435089.1
mRNA parsed from NCBI nr database AF435088.1-GLU.m1 scaffold_7:8581254..8582563
scaffold_7:8592335..8593548
AF435088.1
mRNA parsed from NCBI nr database AJ002748.1-GLU.m1 scaffold_1:9112830..9112974
AJ002748.1

Sequence(s):
>U49454.1-GLU1213
atgactaaatcgaattcgtcatcagttggcagactcctttctctgatttccatagtacttctacttgggcagctggtggt
gggtagcttggcaacaaaacaacacacaggtatgcatatataattggcacctctgtcaatctaactgcaaattacgacat
ttttgtgtgtgtctattttaaagataaggaccaaactgttccatgcaacaaaccacgcatttctaatcaatctcacatgt
aagcaatattaattcctttttcaatgtaggtgctccaattggtgtatgtaatggaatggttggcgatgacctaccacccc
aagcagaagttgttgccctctacaagacaaataacatcccaagaatgcgactttatgatccaaacccagccgctctagaa
gcccttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaaccttcaatacattgccttaagccaagccaa
cgcaaatgcatgggtccaaaacaatgtgagaaactatgccaatgtgaaattcaagtacattgcggtaggaaatgaagtca
agccttcagactcctttgcacagtttctcgtcccagccatgcgaaatattcaagaggcaatttctcttgctggtcttgca
aagaaaattaaagtttcgacagccatcgacaccggagtacttggagagacctttcctccttcgataggctcattcaagtc
tgaatataacgcccttttatatcccatcatccgcttcctagtgagccaccaatcgccattgcttgttaacttgtaccctt
attttgcttacagtggcaacactcaagacattcgtcttgactatgctcttttcacagctccatcagttgtggtacaagat
gggaactttggttaccgaaatcttttcgatgccatgttagatggtgtttatgctgctcttgagaaggctggtggagggtc
tttgaaagttgttatatcagagactggttggccatcagctgctggaacagccacaacaattgataatgcaaggactttta
tatcaaatttgattcaacatgtgaaggaagggactccaaggaggccaggaaggcccatagaaacttacatctttgccatg
tttgatgagaatagaaagaccccagagcttgagaaacattgggggctcttctccccaacaaaacagcctaaataccaaat
cagtttcaattga
back to top
>AF435089.1-GLU1709
atggctaaatccaattcgtcagtcggtagaggcccttcaatgatttcgatagtatttctacttgggctgctgatggctag
ctttgaaacaacaggtatatatctctggcaagattcgtccctattttggcttggaaggctacatagttttgatattctta
caaactttgaggctattaagggctaaaagggccgagctcgtatttgacaattatttatttatttttttactatagatctg
tgggaactgttgcctgatacttttcttttacacaattacttgatttttccaacgaacttctgtgttgcttccatgtctgg
gtcagggtggatggaaacaatgtgcaaaacagaatttaatagcttctacttaaacttcattttcatgtgcaaggttattg
ataagcgggggaagggaagaatgctgttgggttttactttttttcaattgaaaaattatttattatttattttgtccacg
tgtgtacgaaattacaaaaacacccatgtcacgtagtcaaaattaacaaatttttggacggagttgatgttggggggcaa
acaaggccaccaaaatacggtcaagcggggtaagtgagccactttgaatttcagagagcagtgtgagatttgaccgtagt
ttcaagggacattggtgtaaataggccttgaatatattcatgatcattttagcaacaaattatattgtataaatctagtg
aacttttcaccaggatcataaaacctcattataatttcttcaatattgcaggagcccagattggtgtatgttatggaatg
cttggagatcgtttaccacccccatcagaagttattgctctgtataagcaaaataacatcagaaggatgcgactgtatga
tccaaaccaggctgctctagcagcccttaaaggctcttatattgagctcatgctaggcgttccaaatgacaaccttcaaa
gcctagcctcaagccaggccaatgcaaatacttgggtccaaaacaatgtgagaaactatggcaatgtaagattcaaatac
attgcggtaggaaatgaagtcaagccctcagactcctatgcacaatttcttgtcccggccatgcaaaacattcagaacgc
aatttctagtgctggtttgggaattaaagtctccactgccgtagacactggagtgcttggaaattcctttcctccatcga
agggagagttcaagtccgaatatggagcacttttgaaccccatcatccgcttcctagtgaacaacagatcgccgttgctg
gttaatttgtacccgtatttcagctacagcagcaacactcacgacattcgtctagattatgctcttttcacagctccatc
agttgtggtacaagatggccaacgtggctatcgtaatcttttcgatgccattttggacgctgtttatgccgctcttgaga
aggcgggcggagggtctttggaaattgtcatatccgaaagtggttggccatcagctggtggaacggcaacaacaattgat
aatgcaaggacttataatgcaaatctgattcaacatgtgaagggagggactccaaggaagcccggaagggccatagaaac
ctacatctttgccatgtttgatgagaacagaaagaacccagagttggagaaacattgggggctgttttcaccaagcaaac
agccgaaatacccaatcaatttcaactga
back to top
>AF435088.1-GLU1309
atgactaaatcgaattcgtcatcagttggcagatgcctttctctgatttctatagtacttctacttgggcagctggtggt
ggctagcttggcaacaaaacaacacacaggtatgcatatataattggcactgctgtctgtcaatctaactgccaatttag
cttttgtttttctagcgtatgattcatctaactcgtgattaacgaaagccaatgcacaacaaataacgacatttttgtgt
gtgtctatttttaaaacataaggaccaaactgttccatgcaacaaaccacgcattcctaatcaatctcacataaggacca
aattggtgtgtctatttagcaatataaattcctttttcaatgtaggtgctccagttggtgtatgtaatggaatggttggc
gatgacctaccaccccaagcggaagttgttgccctctacaagacaaataacatcccaagaatgcgactttatgatccaaa
cccagccgctctagaagcccttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaaccttcaatacattg
ccttaagccaagccaacgcaaatgcatgggtccaaaacaatgtgagaaactatgccaatgtgaaattcaagtacattgcg
gtaggaaatgaagtcaagccttcagactcctttgcacagtttctcgtcccagccatgcgaaatattcaagaggcaatttc
tcttgctggtcttgcaaagaaaattaaagtttcgacagccatcgacaccggagtacttggagagacctttcctccttcga
taggctcattcaagtctgaatataacgcccttttatatcccatcatccgcttcctagtgagccaccaatcgccattgctt
gttaacttgtacccttattttgcttacagtggcaacactcaagacattcgtcttgactatgctcttttcacagctccatc
agttgtggtacaagatgggaactttggttaccgaaatcttttcgatgccatgttagatggtgtttatgctgctcttgaga
aggctggtggagggtctttgaaagttgttatatcagagactggttggccatcagctgctggaacagccacaacaattgat
aatgcaaggacttttatatcaaatttgattcaacatgtgaaggaagggactccaaggaggccaggaaggcccatagaaac
ttacatctttgccatgtttgatgagaatagaaagacccccgagcttgagaaacattgggggctcttctccccaacaaaac
agcctaaataccaaatcagtttcaattga
back to top
>U49454.1-GLU.m11053
atgactaaatcgaattcgtcatcagttggcagactcctttctctgatttccatagtacttctacttgggcagctggtggt
gggtagcttggcaacaaaacaacacacaggtgctccaattggtgtatgtaatggaatggttggcgatgacctaccacccc
aagcagaagttgttgccctctacaagacaaataacatcccaagaatgcgactttatgatccaaacccagccgctctagaa
gcccttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaaccttcaatacattgccttaagccaagccaa
cgcaaatgcatgggtccaaaacaatgtgagaaactatgccaatgtgaaattcaagtacattgcggtaggaaatgaagtca
agccttcagactcctttgcacagtttctcgtcccagccatgcgaaatattcaagaggcaatttctcttgctggtcttgca
aagaaaattaaagtttcgacagccatcgacaccggagtacttggagagacctttcctccttcgataggctcattcaagtc
tgaatataacgcccttttatatcccatcatccgcttcctagtgagccaccaatcgccattgcttgttaacttgtaccctt
attttgcttacagtggcaacactcaagacattcgtcttgactatgctcttttcacagctccatcagttgtggtacaagat
gggaactttggttaccgaaatcttttcgatgccatgttagatggtgtttatgctgctcttgagaaggctggtggagggtc
tttgaaagttgttatatcagagactggttggccatcagctgctggaacagccacaacaattgataatgcaaggactttta
tatcaaatttgattcaacatgtgaaggaagggactccaaggaggccaggaaggcccatagaaacttacatctttgccatg
tttgatgagaatagaaagaccccagagcttgagaaacattgggggctcttctccccaacaaaacagcctaaataccaaat
cagtttcaattga
back to top
>AF435089.1-GLU.m11032
atggctaaatccaattcgtcagtcggtagaggcccttcaatgatttcgatagtatttctacttgggctgctgatggctag
ctttgaaacaacaggagcccagattggtgtatgttatggaatgcttggagatcgtttaccacccccatcagaagttattg
ctctgtataagcaaaataacatcagaaggatgcgactgtatgatccaaaccaggctgctctagcagcccttaaaggctct
tatattgagctcatgctaggcgttccaaatgacaaccttcaaagcctagcctcaagccaggccaatgcaaatacttgggt
ccaaaacaatgtgagaaactatggcaatgtaagattcaaatacattgcggtaggaaatgaagtcaagccctcagactcct
atgcacaatttcttgtcccggccatgcaaaacattcagaacgcaatttctagtgctggtttgggaattaaagtctccact
gccgtagacactggagtgcttggaaattcctttcctccatcgaagggagagttcaagtccgaatatggagcacttttgaa
ccccatcatccgcttcctagtgaacaacagatcgccgttgctggttaatttgtacccgtatttcagctacagcagcaaca
ctcacgacattcgtctagattatgctcttttcacagctccatcagttgtggtacaagatggccaacgtggctatcgtaat
cttttcgatgccattttggacgctgtttatgccgctcttgagaaggcgggcggagggtctttggaaattgtcatatccga
aagtggttggccatcagctggtggaacggcaacaacaattgataatgcaaggacttataatgcaaatctgattcaacatg
tgaagggagggactccaaggaagcccggaagggccatagaaacctacatctttgccatgtttgatgagaacagaaagaac
ccagagttggagaaacattgggggctgttttcaccaagcaaacagccgaaatacccaatcaatttcaactga
back to top
>AF435088.1-GLU.m11053
atgactaaatcgaattcgtcatcagttggcagatgcctttctctgatttctatagtacttctacttgggcagctggtggt
ggctagcttggcaacaaaacaacacacaggtgctccagttggtgtatgtaatggaatggttggcgatgacctaccacccc
aagcggaagttgttgccctctacaagacaaataacatcccaagaatgcgactttatgatccaaacccagccgctctagaa
gcccttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaaccttcaatacattgccttaagccaagccaa
cgcaaatgcatgggtccaaaacaatgtgagaaactatgccaatgtgaaattcaagtacattgcggtaggaaatgaagtca
agccttcagactcctttgcacagtttctcgtcccagccatgcgaaatattcaagaggcaatttctcttgctggtcttgca
aagaaaattaaagtttcgacagccatcgacaccggagtacttggagagacctttcctccttcgataggctcattcaagtc
tgaatataacgcccttttatatcccatcatccgcttcctagtgagccaccaatcgccattgcttgttaacttgtaccctt
attttgcttacagtggcaacactcaagacattcgtcttgactatgctcttttcacagctccatcagttgtggtacaagat
gggaactttggttaccgaaatcttttcgatgccatgttagatggtgtttatgctgctcttgagaaggctggtggagggtc
tttgaaagttgttatatcagagactggttggccatcagctgctggaacagccacaacaattgataatgcaaggactttta
tatcaaatttgattcaacatgtgaaggaagggactccaaggaggccaggaaggcccatagaaacttacatctttgccatg
tttgatgagaatagaaagacccccgagcttgagaaacattgggggctcttctccccaacaaaacagcctaaataccaaat
cagtttcaattga
back to top
>AJ002748.1-GLU.m1144
atgtttgatgagaataacaaactaggtgaagaaacagagagacactttggggtgttcttcccaactaaagagccaaagta
taacctcaatttcgatacttccgctgggtataatactacaaatacccttaacactgacatgtaa
back to top