RAN4, RAN4 (gene) Prunus salicina

Gene Overview
Name RAN4
Gene Symbol RAN4
Type gene
Organism Prunus salicina
Synonym GTP-binding protein Ran4
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
RAN4KP148823.1-RAN4.m1Prunus salicinamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Responsive to antagonist RANPrunus salicinagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KP148823.1-RAN4.m1 N/A KP148823.1

Sequence(s):
>KP148823.1-RAN4.m1285
gatgtgaagaacaggcaggtcaaggcaaagcaggttactttccacaggaagaagaatattcagtactatgagatatcagc
aaagagcaactataactttgagaagcctttcttatacctcgccagaaagcttgctggggatcataatttgcattttgttg
agtcacctccctcggctcctccagaagtacacattgatctggctgcacaacaacagcaggaagccgagctcgttgcagct
gccagccagccccttcttgatgatgacgatgacacattcgagtag
back to top