S4-RNase, S4-RNase (gene) Prunus salicina

Gene Overview
Name S4-RNase
Gene Symbol S4-RNase
Type gene
Organism Prunus salicina
Synonym S4-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S4-RNaseAF432418.1-S4-RNasePrunus salicinagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S4-RNaseAF432418.1-S4-RNase.m1Prunus salicinamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus salicinagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF432418.1-S4-RNase N/A AF432418.1
mRNA parsed from NCBI nr database AF432418.1-S4-RNase.m1 N/A AF432418.1

Sequence(s):
>AF432418.1-S4-RNase1283
ctatggccaagtaattattcaaacccaaagattcccagtaattgcaagggggcgctatttggggcaaggaaagtggtatg
tacgcatttagtttttagaaaaattagattgtcacatgaagacaatatactttgttgataaaccttgggtgttagataaa
tcctgatgttgctcttctgcttgggaacattattttagatatatacacctaagcacacatttatatttgtagctatatta
atgtacctacctacctacctatacatttataaaagagtactcctattttcatccacccaccttatcttcaaaattttaaa
gagaaatttacccatttgtaaaatgacttctaaaaggacttggggaaaaaagcctcaactcacgtaacccacctattcta
ccgtttgacaaaaagaagaagaagaagaagaaagcgcaatagaaaattaccttcaaatgtataaatttctctttaaaaca
tttatccataatattttcaaaaactacaaggcatataattaaaaaactaaaagatcctgaaaatcaaaatattggactaa
aacatttattgagtccatcaaacacaacttgatcctctccatatctcaattactaatgattagcaaagaaaaatagcttg
aattaataattaaagggtattttaggaataatggtgggtggaaggataagattgtattttttcaaatttacatggtgagt
gggaaaataggacatggggtggaaataacagcactcttataaaaatataagcgatgtcaacggagtctagcatagtgaaa
aatgacattaacttgcaaacaacatgtctcgggttcgaccccgatagcatcttcattttttgtgtgtgtgaaaaatcacc
atctcctgtagtttagactatcttttgtactccaaaaaatgtaaatgatcatctaattaaagcacctatcatatcgtgct
tacgtatatatttaactattgtacatctaaatcaaaattcagtacaatactcaggtttaatatagaaaacaatctaattg
aagaatggatgtatgtgttgcttggatgtctcagtaccctcagttgcaattgaacctgaagatatcttggccggacgtaa
aaagtggcaacgagacaaatttttggcaaagcgaatggaacaagcatggcacatgttctgaacggacactcaaccaaatg
caatacttcgagcgatcagacgaaatgtggaactcgtacaatattacagagatccttaaaaacgcttcaatcgtaccaca
tcc
back to top
>AF432418.1-S4-RNase.m1284
ctatggccaagtaattattcaaacccaaagattcccagtaattgcaagggggcgctatttggggcaaggaaagtgtaccc
tcagttgcaattgaacctgaagatatcttggccggacgtaaaaagtggcaacgagacaaatttttggcaaagcgaatgga
acaagcatggcacatgttctgaacggacactcaaccaaatgcaatacttcgagcgatcagacgaaatgtggaactcgtac
aatattacagagatccttaaaaacgcttcaatcgtaccacatcc
back to top