CAM, AY275526.1-CAM.m1 (mRNA) Pyrus communis

Unique NameAY275526.1-CAM.m1
OrganismPyrus communis (European Pear)

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CAMCAMPyrus communisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AY275526.1-CAM.m1-cds1AY275526.1-CAM.m1-cds1Pyrus communisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CAMAY275526.1-CAM.p1Pyrus communispolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
AY275526 region AY275526:24..416+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>AY275526.1-CAM.m1 ID=AY275526.1-CAM.m1|Name=CAM|organism=Pyrus communis|type=mRNA|length=393bp
back to top

protein sequence of CAM

>AY275526.1-CAM.p1 ID=AY275526.1-CAM.p1|Name=CAM|organism=Pyrus communis|type=polypeptide|length=131bp
back to top

mRNA from alignment at AY275526:24..416+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AY275526.1-CAM.m1 ID=AY275526.1-CAM.m1|Name=CAM|organism=Pyrus communis|type=mRNA|length=393bp|location=Sequence derived from alignment at AY275526:24..416+ (Pyrus communis)
atggccgatcagctcaccgacgaccagatctccgagttcaaggaggcgtt cagcctattcgacaaggacggcgatggttgcatcactacaaaggagttgg ggactgtcatgcgttcacttgggcagaacccaactgaagccgagcttcag gatatgatcaatgaggttgatgctgatgggaatgggaccattgattttcc agagttccttaacttgatggcccggaagatgaaggacaccgattcggagg aggagctcaaggaagccttccgagtgttcgataaggaccagaatggcttc atttctgctgctgagcttcgtcatgttatgacaaatctaggcgagaagct gacagatgaggaagttgatgagatgattcgtgaggctgatgtg
back to top

Coding sequence (CDS) from alignment at AY275526:24..416+

>AY275526.1-CAM.m1 ID=AY275526.1-CAM.m1|Name=CAM|organism=Pyrus communis|type=CDS|length=393bp|location=Sequence derived from alignment at AY275526:24..416+ (Pyrus communis)
back to top