HMG1, HMG1 (gene) Pyrus pyrifolia

Gene Overview
Name HMG1
Gene Symbol HMG1
Type gene
Organism Pyrus pyrifolia
Synonym 3-hydroxy-3-methylglutaryl coenzyme A reductase 1
Pphmgr1
Description NA
Comment Pphmgr1
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
HMG1EU780785.1-HMG1.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
3-hydroxy-3-methylglutaryl-CoA reductaseHMGPyrus pyrifoliagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU780785.1-HMG1.m1 N/A EU780785.1

Sequence(s):
>EU780785.1-HMG1.m11830
atggacgttcgccggcgatctacgatggatacacctgccaccaaggcccgctctgggccgatgaaggtgaatgtcgtgga
ccaagaggaagaggtcggtgccgtcggcgctaaggcctccgatgccctgccgctgcctttgtacctcactaatggggtct
tcttcaccctgtttttctccgttgtctactttcttcttactgcttggcgcgagaagatcaggacttctactcctctccac
gtcgttaccctttctgagatcgtcgcgattctctcgttggtcgcttctgtgatttatcttctggggttcttcgggatcga
gtttgttcagtcgttcattctccggccttccaatgatgtttgttcggcccgatgtgaggaggaagatgatgagcgattta
tcttggaagaagatagtcgtaatggaccttgtggggccgctactgaccgcggttcaattctcccaacaccacctgttgca
gaagttgccccaatagctgttgcacagcaagcttctgataaggaagtcatcctatcgacacctggcgatttcattacaca
accagtgtcggaggaagatgaggagatgatcaaatccgtcctcgcgggaacaattccttcgtactctctggagtcaaaac
tcggtgattgcaagagagctgctgcgattcggagggaggcgcttcagaggatcacagggaagtctctggaagggctacca
ttggagggatttgattatgaatccattctgggtcagtgctgtgagatgccagttggttatgtgcagatacccgttggaat
agctgggcctttgttgcttgatgggagagagtattcggtgccaccgatggcaactactgagggttgcttggttgccagca
ccaaccgtggctgcaaagctatcaacttgtccggcggagccaccagtgtgttgctgagagatgggatgaccagagcgcct
tgtgtgaggttcaactctgctaagagagctgccgagttgaagttctacttggaagaccccaacaattatgacaccttgtc
cgcggttttcaacaggtcaagcagattcggtaggcttcagacaattaagtgtgccattgctgggaagaacttgtacatga
gattcacctgcagcaccggtgatgctatggggatgaacatggtctccaaaggtgcgcaaaacgttttggatttcctccag
aacgacttccctgacatggatgtgattggaatttccggcaactactgctctgacaagaagcccgctgcggtgaactggat
cgaaggtcgtggaaaatcggtggtctgtgaggctgtgatcaagggtgatgtggtgcagaaggtgttgaaaaccaatgtgg
cgtccctgtgcgagcttaacatgctcaagaaccttactgggtctgcaatggctggagccctcggtggattcaacgcacat
gccagcaacatcgtctctgccatctacatcgctaccggccaagacccagctcagaatgtggagagttctcactgcattac
catgatggaacccatcaatgatgggcaggaccttcacgtgtctgtcaccatgccttcaactgaggttggtactgttggag
gtgggacccaacttgcatctcaatcagcttgtctgaaccttcttggagtgaagggtgctaacagggaggcaccaggatct
aatgcaagattgttggccactgttgtggctggttctgttcttgctggagagctttctctcatgtctgctatctcagctgg
acagcttgtgaatagtcacatgaaatacaacagatcaagcaaagatgtctcagctgttgcgtccgcttaa
back to top