XET4, XET4 (gene) Pyrus x bretschneideri

Gene Overview
Name XET4
Gene Symbol XET4
Type gene
Organism Pyrus x bretschneideri
Synonym xyloglucan endotransglucosylase/hydrolase 4
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
XET4KJ690922.1-XET4.m1Pyrus x bretschneiderimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglycosilaseXETPyrus x bretschneiderigene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KJ690922.1-XET4.m1 N/A KJ690922.1

Sequence(s):
>KJ690922.1-XET4.m1891
atggctggttcagcttttggaataatggttttttctctaagtgcttttctgagtcttgcattgctgggtttggtcagctc
agcaaaatttgatgagcttttccagccaacctgggctttcgatcatttcacctacgagggagagcaaattcacatgaaac
ttgacaacttttccggagctgggtttcaatccaagaacaagtacctgtttggaaaagtgagccttcagattaagctcatc
gagggcgactctgctggaaccgtcactgctttctatatgtcatcggacggtccacaacacaatgagttcgactttgagtt
tctggggaacacgacaggggaaccttattcggtgcagaccaatttatacgtgaatggcgtgggaaacagagaacaaagat
tgaacctttggttcgatcccaccacggaattccattcctactccatcttctggaatcagcgccaagtagtgttcctagtg
gatgagacgcccattagagtccacaccaacatggaaaacaaaggagtgccctttcccaaggaccaagccatgggtgtgta
cagttcaatttggaatgcagatgactgggccacacagggtggtagggtcaagacagattggtcccatgcacccttcattg
caacctacaagggctttgaaatcaatgcctgtgagtacccagtttccattgcagctgcagataaggcaaagaagtgcatc
agcaatggtggccagaagtactggtgggatgagcctactttgtcagagctaagtgtccaccagaaccaccagctcgtttg
ggtgaaggctcaccacatggtctacgactactgcaccgattctgctaggtttccggtgactccactcgagtgcgtgcatc
accgccactag
back to top