BRP5, AM075213.1-BRP5.m1 (mRNA) Rosa hybrid cultivar

Unique NameAM075213.1-BRP5.m1
OrganismRosa hybrid cultivar ()

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP5AM075213.1-BRP5Rosa hybrid cultivargene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP5BRP5Rosa hybrid cultivargene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AM075213.1-BRP5.m1-cds1AM075213.1-BRP5.m1-cds1Rosa hybrid cultivarCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
BRP5AM075213.1-BRP5.p1Rosa hybrid cultivarpolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
AM075213 region AM075213:1..471+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>AM075213.1-BRP5.m1 ID=AM075213.1-BRP5.m1|Name=BRP5|organism=Rosa hybrid cultivar|type=mRNA|length=471bp
back to top

protein sequence of BRP5

>AM075213.1-BRP5.p1 ID=AM075213.1-BRP5.p1|Name=BRP5|organism=Rosa hybrid cultivar|type=polypeptide|length=157bp
back to top

mRNA from alignment at AM075213:1..471+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM075213.1-BRP5.m1 ID=AM075213.1-BRP5.m1|Name=BRP5|organism=Rosa hybrid cultivar|type=mRNA|length=471bp|location=Sequence derived from alignment at AM075213:1..471+ (Rosa hybrid cultivar)
cttgcacaagctttttatgataaaatctctgatcaatttcgagataaatg ctttctgaaaaatgttagagagatttctagacgagacggtattgttgcat taacaaaagatctcctttgcaatgtcttaaaaaggatggatttgtatgat agtgagataaggcatagatttcgtcgtaaaaaggttctcatcattctgga tgatgtagataagttggaacaattgcaagcattagctggaagcaagaatt ggtttggtcgagggagtaggatcattataacaaccagggacagacaattg ttgattgctcatcatgtggatagatgtttcaaggtcaaggaattgaaaag tgatgatggccttaagcttttcagttggaaagccttccagaatgatcaac ccccaaaagattatatagagttatcctataactttgtaaattactgtaag ggccttcctttagctatcaaa
back to top

Coding sequence (CDS) from alignment at AM075213:1..471+

>AM075213.1-BRP5.m1 ID=AM075213.1-BRP5.m1|Name=BRP5|organism=Rosa hybrid cultivar|type=CDS|length=471bp|location=Sequence derived from alignment at AM075213:1..471+ (Rosa hybrid cultivar)
back to top