BRP2, BRP2 (gene) Rosa hybrid cultivar

Gene Overview
Name BRP2
Gene Symbol BRP2
Type gene
Organism Rosa hybrid cultivar
Synonym putative TIR-NBS-LRR resistance protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BRP2AM075210.1-BRP2Rosa hybrid cultivargene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BRP2AM075210.1-BRP2.m1Rosa hybrid cultivarmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Broad resistance to Peronospora parasitica in ArabidopsisBRPRosa hybrid cultivargene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AM075210.1-BRP2 N/A AM075210.1
mRNA parsed from NCBI nr database AM075210.1-BRP2.m1 N/A AM075210.1

Sequence(s):
>AM075210.1-BRP2562
gttgccaaagccatctataacaaattttatcatgactttaacagtagaagtttcctagcagatgttagggaaacagcaaa
ggacccaagtggtaagattgcactgcaagaaagacttctttctgatgtcttaaaaccaaccaagatagaggtaggtgatg
tttccaaaggcatcaatgtgatcaaagaacgacttagaagcaaaaaggtacttgtcatcgttgacaatgtcgatcgtctg
gaacaattgaatgcattcgcaataagccgtgattcctttggtctgggaggtataattattataacaacaagagatcgaca
tttgttacaacaagtgagagcggataaaatacatctgacacaagaaatgaatgaagaagaagctcttgagctcttcagtt
ggcatgcctttcaaaattattctcctaaggaagactatatcgaactctcaagaagagtggttacttactgtggaggttta
ccgctggctcttgaagttttagggtctttcctctttggaaggagcataggagattggaatagcacactgaagaaattgga
at
back to top
>AM075210.1-BRP2.m1562
gttgccaaagccatctataacaaattttatcatgactttaacagtagaagtttcctagcagatgttagggaaacagcaaa
ggacccaagtggtaagattgcactgcaagaaagacttctttctgatgtcttaaaaccaaccaagatagaggtaggtgatg
tttccaaaggcatcaatgtgatcaaagaacgacttagaagcaaaaaggtacttgtcatcgttgacaatgtcgatcgtctg
gaacaattgaatgcattcgcaataagccgtgattcctttggtctgggaggtataattattataacaacaagagatcgaca
tttgttacaacaagtgagagcggataaaatacatctgacacaagaaatgaatgaagaagaagctcttgagctcttcagtt
ggcatgcctttcaaaattattctcctaaggaagactatatcgaactctcaagaagagtggttacttactgtggaggttta
ccgctggctcttgaagttttagggtctttcctctttggaaggagcataggagattggaatagcacactgaagaaattgga
at
back to top