BRP37, BRP37 (gene) Rosa hybrid cultivar

Gene Overview
Name BRP37
Gene Symbol BRP37
Type gene
Organism Rosa hybrid cultivar
Synonym putative LZ-NBS-LRR resistance protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BRP37AM075245.1-BRP37Rosa hybrid cultivargene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BRP37AM075245.1-BRP37.m1Rosa hybrid cultivarmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Broad resistance to Peronospora parasitica in ArabidopsisBRPRosa hybrid cultivargene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AM075245.1-BRP37 N/A AM075245.1
mRNA parsed from NCBI nr database AM075245.1-BRP37.m1 N/A AM075245.1

Sequence(s):
>AM075245.1-BRP37677
cttgcccaagatgcctataacgatgaaagggttacagcccattttgataagaaagtatgggtttgtgtctcagacccttt
tgatgagatcaagattgctaaagcgatcattgaaagtctcgtaggaaccccaaacagttcaaatgagttggaaattttat
tgcaatgtatcaagactcatatcgagaatcatatcgagaataggaagttacttcttgttctagatgatgtgtggaccgaa
gacgaaacaaagtgggaaaatttgaaactaccaataataatgcaaagttgtgaagaaggaagttcaatactggtgaccac
gcgaaaacaagaggttgctaaaattatgagagcaaccaacaacatgatccatttagatgagttgaattataaggattgtt
tggctttgttcaatagcattgcgtttttggatagggatgaagatgaggctgatgagttgggagatattggtaagaaaatt
gtgaaacggtgtaaaggtttgcctcttgctgcaaagactttaggtagtctagtgtggtataagaaaacaagaaaggaatg
ggaggatgttctgaagagtgagatatgggaattagaaaaagttgagcaacatgttttccgaccactgttgcttagttatt
atgatttggctcctgcagtcaaaagatgtcttttgta
back to top
>AM075245.1-BRP37.m1677
cttgcccaagatgcctataacgatgaaagggttacagcccattttgataagaaagtatgggtttgtgtctcagacccttt
tgatgagatcaagattgctaaagcgatcattgaaagtctcgtaggaaccccaaacagttcaaatgagttggaaattttat
tgcaatgtatcaagactcatatcgagaatcatatcgagaataggaagttacttcttgttctagatgatgtgtggaccgaa
gacgaaacaaagtgggaaaatttgaaactaccaataataatgcaaagttgtgaagaaggaagttcaatactggtgaccac
gcgaaaacaagaggttgctaaaattatgagagcaaccaacaacatgatccatttagatgagttgaattataaggattgtt
tggctttgttcaatagcattgcgtttttggatagggatgaagatgaggctgatgagttgggagatattggtaagaaaatt
gtgaaacggtgtaaaggtttgcctcttgctgcaaagactttaggtagtctagtgtggtataagaaaacaagaaaggaatg
ggaggatgttctgaagagtgagatatgggaattagaaaaagttgagcaacatgttttccgaccactgttgcttagttatt
atgatttggctcctgcagtcaaaagatgtcttttgta
back to top