01a6 (genetic_marker) Rosa sp.

Marker Overview
Genbank IDN/A
SpeciesMalus x domestica
Repeat Motif(ga)21
Primer 101a6.forward primer: aggattgctggaaaaggagg
Primer 201a6.reverse primer: tta gac gac gct act tgt cct
Primer 3NZ01a6.forward primer: aggattgctggaaaaggagg
Primer 4NZ01a6.reverse primer: tta gac gac gct act tgt cct
Product Length136
Publication[view all]
ContactA. Torres
Johan Van Huylenbroeck
P. Guilford

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer01a6.forward primerMalus x domesticaprimer
reverse primer01a6.reverse primerMalus x domesticaprimer
forward primerNZ01a6.forward primerMalus x domesticaprimer
reverse primerNZ01a6.reverse primerMalus x domesticaprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
01a6NZ01a6Malus x domesticamarker_locus

Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
A. Torres
First name:A. M.
Last name:Torres
Institution:Departamento de Mejora y Agronomı´a, CIFA-Alameda del Obispo (IFAPA)
Address:Apdo 3092, 14080 Co´ rdoba, Spain
Johan Van Huylenbroeck
First name:Johan
Last name:Van Huylenbroeck
Institution:Applied Genetics and Breeding, Plant Sciences Unit, Institute for Agricultural and Fisheries Research (ILVO)
Address:Caritasstraat 21, 9090 Melle, Belgium
P. Guilford
First name:P.
Last name:Guilford
Institution:Horticulture and Food Research Institute of New Zealand
Address:Horticulture and Food Research Institute of New Zealand, Mt Albert Research Centre, Private Bag 92 169, Auckland, New Zealand
Country:New Zealand