Xth2, Xth2 (gene) Rosa x borboniana

Gene Overview
Name Xth2
Gene Symbol Xth2
Type gene
Organism Rosa x borboniana
Synonym xyloglucan endotransglucosylase/hydrolase 2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
xyloglucan endotransglucosylase hydrolaseXTHRosa x borbonianagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Xth2DQ320658.2-Xth2.m1Rosa x borbonianamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ320658.2-Xth2.m1 N/A DQ320658.2

Sequence(s):
>DQ320658.2-Xth2.m1864
atgaggagtagtgttactgcttctatttccctttgtttcctttcactattttccctctcagcctttgcacgaccagccac
ttttcttcaggatttccaagtcacatggtctgattctcatatcaggcaaatcgatggagggagggccatccaactcgttc
ttgaccaaaactctggttgtggcttttcctccaaacacaagtacttgtttggccgtgtgagcatgaagatcaagctcatt
cccggtgactctgccggaactgtcaccgctttctatatgaactcggacacagatacagtacgtgatgagcttgattttga
gttcttggggaacaggactggacagccttacacagtccagaccaatatctatgctcgtggacagggtaacagggagcaaa
gggtgaacctctggtttgaccctgctgcagatttccacacttacacaattctctggaaccatcaccatattgtcttctat
gtagatgatgtgcctatcaggctgtacaagaacaatgaagcgaaaggaatcccatacccaaagctccaacccatgggggt
gttctcaacattgtgggaagctgatgattgggcaacaagaggagggcttgagaagataaactggagcaaagcccccttct
atgcttattacaaggactttgacatcgaaggatgctctgtgccaggaccagctaattgtgcctcaagcactaataactgg
tgggaaggcactgcttaccaagcactcaatgcccttgaatatagaagatacaagtgggttcgtatgaaccacatgatcta
cgattactgctccgacagatcccggttcccaaaacccccacccgagtgtgtcgccggcctctaa
back to top