BPPCT025, BPPCT025 (genetic_marker) Prunus persica

Marker Overview


Name	BPPCT025
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Germplasm	OHenry
Source Type	Genomic DNA
Repeat Motif	(GA)29
PCR Condition	94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min
Primer 1	BPPCT025.F primer: TCCTGCGTAGAAGAAGGTAGC
Primer 2	BPPCT025.R primer: CGACATAAAGTCCAAATGGC
Product Length	197
Publication	[view all]
Contact	E. Dirlewanger
Associated With	GWAS0001945

Contact

Name

Details

E. Dirlewanger

First name:	Elisabeth
Last name:	Dirlewanger
Institution:	INRA
Address:	Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:	France
Email:	dirlewan@bordeaux.inra.fr

Analyses

This genetic_marker is derived from or has results from the following analyses


Analysis Name	Date Performed
GDR Markers Database	2004-01-01

Publications


Year	Publication
2002	Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138.
2005	Yamamoto T, Yamaguchi M, Hayashi T. An Integrated Genetic Linkage Map of Peach by SSR, STS, AFLP and RAPD. Journal of the Japanese Society for Horticultural Science. 2005; 74(3):204-213.

Germplasm


Stock Name	Type
OHenry	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Almond-NL-F1-2010	G6	N/A	40.52	BPPCT025	View
2	Peach-JF-F2	G6	N/A	59.6	BPPCT025	View
3	Peach-AJ-F2-2005	G6	N/A	55.2	BPPCT025	View
4	Prunus Bin Map	LG6	N/A	56.4	BPPCT025	View
5	Prunus-TE-F2	G6	N/A	56.4	BPPCT025	View
6	Peach-GN-F2	G6B	N/A	66	BPPCT025	View
7	Peach-ScB-F2-2007	G6	N/A	53.78	BPPCT025	View
8	Peach-AJ-F2	G6	N/A	55.2	BPPCT025	View
9	Peach-CF-F2-2014	6	N/A	34.01	BPPCT025	View
10	Peach-PF-BC1-2005	G6	N/A	46.3	BPPCT025	View
11	Almond-VB-F1	G6	N/A	18.8	BPPCT025	View
12	Peach-VV-F2	G6	N/A	21.1	BPPCT025	View
13	Peach-LAxFG-F2	LG6	N/A	71.5	BPPCT025	View
14	Peach_CxEL_F1-physical-Prunus-persicaV1.0	CxEL6	N/A	21129947	BPPCT025	View
15	Chokecherry-RCxSC-F1-2014	RC V	N/A	53.2	BPPCT025	View
16	Peach-DvsS-BC2	LG6	N/A	39	BPPCT025	View
17	Prunus-TE-F2-2015	6	N/A	53.9	BPPCT025	View
18	Prunus-TE-BC1-T1E	G6_T1E	N/A	24.1	BPPCT025	View
19	Prunus-TE-BC1-E	G6_E	N/A	62.6	BPPCT025	View
20	Prunus-TxE-peachV2.0	LG6	N/A	56.4	BPPCT025	View
21	Peach-CA-BC1-2017	LG6	N/A	56.6	BPPCT025	View
22	Peach-CF-F2	G6	N/A	23	BPPCT025	View
23	Peach-DG-F1-2009	G6	N/A	73	BPPCT025A	View
24	Peach_Consensus_map_2018	6	N/A	46.66	BPPCT025	View

Alignments

Feature Name	Type	Location	Analysis
scaffold_6	supercontig	scaffold_6:21129947..21129947.	Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp06	chromosome	Pp06:22994304..22994500.	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)

Annotated Terms

The following terms have been associated with this genetic_marker:

Vocabulary: **Rosaceae Trait Ontology**
Term	Definition
28:full bloom date	flower date 100%