CPPCT030, CPPCT030 (genetic_marker) Prunus persica | GDR

Marker Overview

Marker Overview


Name	CPPCT030
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Source Type	Genomic DNA
Repeat Motif	(CT)30
PCR Condition	94 C 1 min, 94 C 30 sec, 50 C 30 sec, 72 C 1 min. 34 cycles, 72 C 5min
Primer 1	CPPCT030.Forward Primer: TGAATATTGTTCCTCAATTCCTCTAGGCAAGAGATGAGA
Primer 2	CPPCT030.primer 1: TGAATATTGTTCCTCAATTCCTCTAGGCAAGAGATGAGA
Product Length	198
Publication	[view all]
Contact	E. Dirlewanger Maria Badenes

Contact

Name

Details

E. Dirlewanger

First name:	Elisabeth
Last name:	Dirlewanger
Institution:	INRA
Address:	Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:	France
Email:	dirlewan@bordeaux.inra.fr

Maria Badenes

First name:	Maria
Last name:	Badenes
Institution:	Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:	Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	badenes_mlu@gva.es

Analyses

This genetic_marker is derived from or has results from the following analyses


Analysis Name	Date Performed
GDR Markers Database	2004-01-01
Alignment of genetic markers to Prunus persics v2.0	2019-04-11

Publications


Year	Publication
2002	Plant breeding = Zeitschrift fr Pflanzenzchtung. Plant breed. Feb 2002. v. 121 (1) p. 87-92. ISSN 0179-9541; PLABED
2002	Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Prunus Bin Map	LG6	N/A	80.2	CPPCT030	View
2	Prunus-TE-F2	G6	N/A	80.2	CPPCT030	View
3	Almond-RD-F1	G6	N/A	58.2	CPPCT030	View
4	Peach-DG-F1-2009	G6	N/A	117.1	CPPCT030	View
5	Peach-DvsS-BC2	LG6	N/A	47	CPPCT030	View
6	Prunus-TE-F2-2015	6	N/A	76.2	CPPCT030	View
7	Prunus-TxE-peachV2.0	LG6	N/A	80.2	CPPCT030	View
8	Sweet Cherry-PAxPN-94	G6	N/A	86.5	nCPPCT030	View
9	Sweet Cherry-47	G6	N/A	110.1	nCPPCT030	View
10	Peach_Consensus_map_2018	6	N/A	69.56	CPPCT030	View

Alignments

Feature Name	Type	Location	Analysis
scaffold_6	supercontig	scaffold_6:26851012..26851314.	Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp06	chromosome	Pp06:28715620..28715922+	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)