|
Marker Overview
Name | MA021a |
Genbank ID | N/A |
Type | SSR |
Species | Prunus persica |
Germplasm | Akatsuki |
Source Type | genomic DNA |
Repeat Motif | AG |
Primer 1 | MA021a.F primer: TGAGCTCCGATCATTATAGA |
Primer 2 | MA021a.R primer: CACAGGATGGGCGTATCTTT |
Product Length | 227 |
Publication | [view all] |
Contact | T. Yamamoto Amy Iezzoni
|
Alignments
The following features are aligned
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2002 | Yamamoto T, Mochida K, Imai T, Shi Y.Z, Ogiwara I, Hayashi T. Microsatellite markers in peach [Prunus persica (L.) Batsch] derived from an enriched genomic and cDNA libraries. Molecular Ecology Notes. 2002; 2(3):298-301. |
2008 | Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910. |
|