|
Marker Overview
Name | MD206a |
Genbank ID | AF129073 |
Type | SSR |
Species | Prunus persica |
Source Type | gene |
Repeat Motif | (GA)3G(GA)2G(GA)5 |
PCR Condition | 94 C 5 min, 94 C 1 min, 55 C 1 min, 72 C 2 min. 35 cycles, 72 C 7min |
Primer 1 | MD206a.F primer: ATTGAGGCCCTCCAAGTTGATG |
Primer 2 | MD206a.Forward Primer: ATTGAGGCCCTCCAAGTTGATG |
Primer 3 | MD206a.R primer: CCAGGACCAAAATTACCAACAC |
Primer 4 | MD206a.Reverse Primer: CCAGGACCAAAATTACCAACAC |
Product Length | 118 |
Publication | [view all] |
Contact | P. Arus Maria Badenes
|
Alignments
The following features are aligned
Analyses
This genetic_marker is derived from or has results from the following analyses
|