RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5, RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5 (genetic_marker) Malus x domestica

Marker Overview

Name

RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5

dbSNP ID

SNP Array ID

480K SNP array for apple:	AX-115182523
IRSC 9K SNP array for apple:	RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5
50K SNP array for apple:	AX-105199708

Type

SNP

SNP Alleles

5' Flanking Sequence

GCAGTTGCAAAATCTGGAATTGTGGATAGTCTTCT

3' Flanking Sequence

TCTTGGGCAAATTTTAAACAGAACAAAGACCTGA

Species

Malus x domestica

Publication

[view all]

Libraries


Library Name	Type
480K SNP array for apple	SNP_chip
IRSC 9K SNP array for apple	SNP_chip
50K SNP array for apple	SNP_chip

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
MDC016877.182	contig	MDC016877.182:9644..9644 .	Malus x domestica Whole Genome v1.0 Assembly & Annotation	n/a
Chr07	chromosome	Chr07:1532685..1532685 +	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	n/a
Chr02	chromosome	Chr02:36329714..36329714 -	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	n/a

Analyses

This genetic_marker is derived from or has results from the following analyses


Analysis Name	Date Performed
RosBREED SNP development	2011-01-01

Publications


Year	Publication
2013	Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407.
2016	Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
2020	Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-M432-2013	2	N/A	74.1	RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5	View
2	Apple-M432-2013-physical-Malus-domestica	2	N/A	38935589	RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5	View
3	Apple-BB-F1	2	N/A	77.13	RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5	View
4	Apple-NC-F1	2	N/A	82.04	RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5	View
5	Apple-NCZFBB-consensus	2	N/A	76.79	RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5	View
6	Apple-ZF-F1	2	N/A	81.72	RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5	View

Sequence

>RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5 ID=RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5; Name=RosBREEDSNP_SNP_CT_38935589_Lg2_00995_MAF30_MDP0000211904_exon5; organism=Malus x domestica; type=genetic_marker; length=75bp
GCAGTTGCAAAATCTGGAATTGTGGATAGTCTTCT[C/T]TCTTGGGCAA
ATTTTAAACAGAACAAAGACCTGAA