RosBREEDSNP_SNP_GA_22644483_Lg13_RosCOS1496_MAF40_47204_exon1, RosBREEDSNP_SNP_GA_22644483_Lg13_RosCOS1496_MAF40_47204_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_22644483_Lg13_RosCOS1496_MAF40_47204_exon1
dbSNP IDss475880912
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_22644483_Lg13_RosCOS1496_MAF40_47204_exon1
50K SNP array for apple:AX-105209692
TypeSNP
SNP AllelesA/G
5' Flanking SequenceGTCGCTATGATAACCGACAAGAAACGTATATTACT
3' Flanking SequenceTCTGATATTAAGCAAAATCCAGCAGAAAATAGAT
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201316N/A51.87RosBREEDSNP_SNP_GA_22644483_Lg13_RosCOS1496_MAF40_47204_exon1View
2Apple-M432-2013-physical-Malus-domestica13N/A22644483RosBREEDSNP_SNP_GA_22644483_Lg13_RosCOS1496_MAF40_47204_exon1View
Sequence
>RosBREEDSNP_SNP_GA_22644483_Lg13_RosCOS1496_MAF40_47204_exon1 ID=RosBREEDSNP_SNP_GA_22644483_Lg13_RosCOS1496_MAF40_47204_exon1; Name=RosBREEDSNP_SNP_GA_22644483_Lg13_RosCOS1496_MAF40_47204_exon1; organism=Malus x domestica; type=genetic_marker; length=70bp
GTCGCTATGATAACCGACAAGAAACGTATATTACTRTCTGATATTAAGCA
AAATCCAGCAGAAAATAGAT
Alignments
Feature NameTypeLocationAnalysis
MDC029422.38 contig MDC029422.38:609..609. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr16 chromosome Chr16:17880101..17880101. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation