RosBREEDSNP_SNP_GA_10720575_Lg10_01867_MAF40_1682345_exon2, RosBREEDSNP_SNP_GA_10720575_Lg10_01867_MAF40_1682345_exon2 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_10720575_Lg10_01867_MAF40_1682345_exon2
Aliasss475879678
rs267612624
a475879678
SNP_GA_10720575_Lg10_01867_MAF40_1682345_exon2
AX-105200580
dbSNP IDss475879678
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_10720575_Lg10_01867_MAF40_1682345_exon2
50K SNP array for apple:RosBREEDSNP_SNP_GA_10720575_Lg10_01867_MAF40_1682345_exon2
TypeSNP
SNP AllelesA/G
5' Flanking SequenceACACCATTGCTTGCTATTGCTCCTCGGTCCACATA
3' Flanking SequenceTTTATCAAGTTAATCAAGCAAAAGATAACAAGTA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_GA_10720575_Lg10_01867_MAF40_1682345_exon2RosBREEDSNP_SNP_GA_10720575_Lg10_01867_MAF40_1682345_exon2Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GA_10720575_Lg10_01867_MAF40_1682345_exon2 ID=RosBREEDSNP_SNP_GA_10720575_Lg10_01867_MAF40_1682345_exon2|Name=RosBREEDSNP_SNP_GA_10720575_Lg10_01867_MAF40_1682345_exon2|organism=Malus x domestica|type=genetic_marker|length=70bp
ACACCATTGCTTGCTATTGCTCCTCGGTCCACATARTTTATCAAGTTAAT
CAAGCAAAAGATAACAAGTA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-2013-physical-Malus-domestica10N/A10720575RosBREEDSNP_SNP_GA_10720575_Lg10_01867_MAF40_1682345_exon2View
Alignments
Feature NameTypeLocationAnalysis
MDC004870.197 contig MDC004870.197:17190..17190. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr02 chromosome Chr02:13249145..13249145. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr05 chromosome Chr05:8831377..8831377. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr10 chromosome Chr10:7879299..7879299. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr13 chromosome Chr13:19459372..19459372. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr10 chromosome Chr10:7879297..7879297. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation