RosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4, RosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4
Aliasss475876981
rs267609928
b475876981
SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4
AX-105188204
dbSNP IDss475876981
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4
50K SNP array for apple:RosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4
TypeSNP
SNP AllelesA/G
5' Flanking SequenceGAGTCACCTTCAACACGTTGAACCTCTTAGTCTCG
3' Flanking SequenceACAGTGGCCTGAACATTGGTAAAGTACCCAAAAA
SpeciesMalus x domestica
PolymorphismP_ RosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4RosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4 ID=RosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4|Name=RosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4|organism=Malus x domestica|type=genetic_marker|length=70bp
GAGTCACCTTCAACACGTTGAACCTCTTAGTCTCGRACAGTGGCCTGAAC
ATTGGTAAAGTACCCAAAAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20132N/A5.2RosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4View
2Apple-M432-2013-physical-Malus-domestica2N/A1939660RosBREEDSNP_SNP_AG_1939660_Lg2_AAT1_MAF40_MDP0000145727_exon4View
Alignments
Feature NameTypeLocationAnalysis
MDC017657.246 contig MDC017657.246:5958..5958. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr02 chromosome Chr02:897547..897547. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr02 chromosome Chr02:897546..897546. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation