RosBREEDSNP_SNP_AG_607115_Lg13_01579_MAF20_MDP0000269671_exon5, RosBREEDSNP_SNP_AG_607115_Lg13_01579_MAF20_MDP0000269671_exon5 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_607115_Lg13_01579_MAF20_MDP0000269671_exon5
dbSNP IDss475880681
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_607115_Lg13_01579_MAF20_MDP0000269671_exon5
50K SNP array for apple:AX-105223283
TypeSNP
SNP AllelesA/G
5' Flanking SequenceCGAAGTTCCGAATCGCATCGAGGAAGGCAGGGTCG
3' Flanking SequenceGATTCCTAATCTTATTGAGCATATCGGGGTCGAGT
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201314N/A33.57RosBREEDSNP_SNP_AG_607115_Lg13_01579_MAF20_MDP0000269671_exon5View
2Apple-M432-2013-physical-Malus-domestica13N/A607115RosBREEDSNP_SNP_AG_607115_Lg13_01579_MAF20_MDP0000269671_exon5View
Sequence
>RosBREEDSNP_SNP_AG_607115_Lg13_01579_MAF20_MDP0000269671_exon5 ID=RosBREEDSNP_SNP_AG_607115_Lg13_01579_MAF20_MDP0000269671_exon5; Name=RosBREEDSNP_SNP_AG_607115_Lg13_01579_MAF20_MDP0000269671_exon5; organism=Malus x domestica; type=genetic_marker; length=71bp
CGAAGTTCCGAATCGCATCGAGGAAGGCAGGGTCGRGATTCCTAATCTTA
TTGAGCATATCGGGGTCGAGT
Alignments
Feature NameTypeLocationAnalysis
MDC001747.427 contig MDC001747.427:14205..14205. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr02 chromosome Chr02:34089598..34089598. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr13 chromosome Chr13:714056..714056. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation