|
Marker Overview
Name | RosBREEDSNP_SNP_TC_4428268_Lg16_182011_MAF10_182011_exon1 |
dbSNP ID | ss475876565 |
SNP Array ID | 480K SNP array for apple: | AX-115182898 | IRSC 9K SNP array for apple: | RosBREEDSNP_SNP_TC_4428268_Lg16_182011_MAF10_182011_exon1 | 50K SNP array for apple: | AX-105212609 |
|
Type | SNP |
SNP Alleles | Y |
5' Flanking Sequence | TTTTGATCTTTCGTATGTTCCTAGACGAGGTCGGG |
3' Flanking Sequence | TTTCGAACTTCGAATTCACCGGAGGCTGTGTGAAT |
Species | Malus x domestica |
Publication | [view all] |
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2013 | Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407. |
2016 | Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26. |
2020 | Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8 |
Sequence
>RosBREEDSNP_SNP_TC_4428268_Lg16_182011_MAF10_182011_exon1 ID=RosBREEDSNP_SNP_TC_4428268_Lg16_182011_MAF10_182011_exon1; Name=RosBREEDSNP_SNP_TC_4428268_Lg16_182011_MAF10_182011_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp ATTCACACAGCCTCCGGTGAATTCGAAGTTCGAAA[C/T]CCCGACCTCG TCTAGGAACATACGAAAGATCAAAA
|