RosBREEDSNP_SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4, RosBREEDSNP_SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4
Aliasss475877045
rs267609992
c475877045
SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4
AX-105208160
dbSNP IDss475877045
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4
50K SNP array for apple:RosBREEDSNP_SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4
TypeSNP
SNP AllelesT/C
5' Flanking SequenceAACTGGTCCAAAACCACCCTCTCCGAGCTTGCTGC
3' Flanking SequenceAGATGAGAAATTATTCGTTGCAGCTACTATTCCA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4RosBREEDSNP_SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4 ID=RosBREEDSNP_SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4|Name=RosBREEDSNP_SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4|organism=Malus x domestica|type=genetic_marker|length=70bp
AACTGGTCCAAAACCACCCTCTCCGAGCTTGCTGCYAGATGAGAAATTAT
TCGTTGCAGCTACTATTCCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20132N/A10.24RosBREEDSNP_SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4View
2Apple-M432-2013-physical-Malus-domestica2N/A4328900RosBREEDSNP_SNP_CT_4328900_Lg2_01945_MAF30_MDP0000137471_exon4View
Alignments
Feature NameTypeLocationAnalysis
MDC007301.205 contig MDC007301.205:3084..3084. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr02 chromosome Chr02:3768554..3768554. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr02 chromosome Chr02:3776737..3776737. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation