|
Marker Overview
Name | GDsnp00368 |
dbSNP ID | ss475882420 |
SNP Array ID | 480K SNP array for apple: | AX-115181981 | IRSC 9K SNP array for apple: | GDsnp00368 | 20K SNP array for apple: | GDsnp00368 | 50K SNP array for apple: | AX-105205859 |
|
Type | SNP |
SNP Alleles | A/G |
Probe 1 | GDsnp00368.probe: CAAGTATTCTTCAGTGATCATGTTGCCAACGATTTCAACACCCTTTTCGC |
5' Flanking Sequence | ACGAAGAATGCACGAAATGAAGCGAGGACTTGGGGAATAACTGGCCGTGGAAAGATCCCG
GCACGCCAGCTGCAAAGTACTGCCTTTCCGGAGGCAAAGA |
3' Flanking Sequence | GCGAAAAGGGTGTTGAAATCGTTGGCAACATGATCACTGAAGAATACTTGGAATTCAGGC
ATTTGGGAGGAGATGCATTGGGATTGGTACTTGTGGTTCA |
Species | Malus x domestica |
Publication | [view all] |
Contact | Michela Troggio
|
Alignments
The following features are aligned
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2010 | Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839. |
2014 | Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377. |
2013 | Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407. |
2016 | Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26. |
2020 | Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8 |
Sequence
>GDsnp00368 ID=GDsnp00368; Name=GDsnp00368; organism=Malus x domestica; type=genetic_marker; length=75bp CCAGCTGCAAAGTACTGCCTTTCCGGAGGCAAAGA[C/T]GCGAAAAGGG TGTTGAAATCGTTGGCAACATGATC
|