RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5, RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5
Aliasss475880097
rs267613042
b475880097
SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5
AX-105189424
dbSNP IDss475880097
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5
50K SNP array for apple:RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTTGCTATGTCATTCATCGACAAGCACAAATAACTT
3' Flanking SequenceCATGAGCTCTGAGAATACTGTAAACACAGAAAAAA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5Malus x domesticamarker_locus
RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5-70.72Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5 ID=RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5|Name=RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5|organism=Malus x domestica|type=genetic_marker|length=71bp
TTGCTATGTCATTCATCGACAAGCACAAATAACTTRCATGAGCTCTGAGA
ATACTGTAAACACAGAAAAAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-2013-physical-Malus-domestica11N/A8445216RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5View
2Pear-PH-CG-2017LG3N/A70.72RosBREEDSNP_SNP_GA_8445216_Lg11_00185_MAF40_531216_exon5View
Alignments
Feature NameTypeLocationAnalysis
MDC004975.134 contig MDC004975.134:13865..13865. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr11 chromosome Chr11:7652227..7652227. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr11 chromosome Chr11:7652226..7652226. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation