MADS3, MADS3 (gene) Prunus avium

Gene Overview
Name MADS3
Gene Symbol MADS3
Type gene
Organism Prunus avium
Synonym transcription factor MADS3
Description NA
Comment MADS-box protein
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS3HQ229605.1-MADS3.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPrunus aviumgene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HQ229605.1-MADS3.m1 scaffold_1:22775641..22779896
HQ229605.1

Sequence(s):
>HQ229605.1-MADS3.m1723
atggggagggggagagtggagctgaagaggattgagaacaagatcaacaggcaggtgacctttgcgaagagaaggaacgg
gcttttgaagaaagcctacgagctttccgttctttgcgaggctgaggttgctctcatcatcttctccaatagaggaaagc
tgtacgagttttgcagtagctcaagcatgctcaaaactcttgagaggtaccagaagtgcaactatggagcaccagagaca
aatgtatctgcaagggaggccttggaattgagtagccagcaggagtatttgaagctcaaggcacgttatgaagccctaca
acgaaaccaaaggaatcttcttggagaagatcttggccctttaagcagcaaagagcttgaatcacttgaaaggcagctgg
atatgtcactgaagcagatcagatcgacacggacccaatacatgctggatcagctcacagatcttcagcgaaaggagcac
atgctaaatgaagcaaataagaccctgaaacaaaggttgtttgagggataccatgtaaattcactccaaatgaatccaaa
tgctgacgagtacggccggcaacaagctcaagctcacggcgatggcttcttccatcccttagactgcgagccgacgttac
agattggataccagaacgatccaatatcagtggtcacagcaggtccaagcgtgagtaattacatggcaggatggttgcca
tga
back to top