DOF8, DOF8 (gene) Malus x domestica

Gene Overview
Name DOF8
Gene Symbol DOF8
Type gene
Organism Malus x domestica
Synonym DOF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DOF8HM122549.1-DOF8.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
DOF domain class transcription factorDOFMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122549.1-DOF8.m1 Chr12:9562310..9563216
chr12:25429365..25430271
HM122549.1

Sequence(s):
>HM122549.1-DOF8.m1906
atggcagatcgagctcgcatggccaacatccccctccctgagcaagcactaaaatgtccgcggtgcgaatccaccaacac
taagttctgctacttcaacaactacagcctcacacagccccgccacttctgcaagacttgtagaaggtactggacgagag
gcggggccctgcgaaatgttccagttggcggcggctgcaggagaaacaaaaggagcaaaggaaccagtagcagcgcctcc
aagtccccagccagcagctcggacaggccaaccggttcggccggttcgtcgggccacgcaaatttagggttaaacaacag
tagcacggccggctcggcggataataataacatgaggatgagcccgcacatcccaccgctgcgtttcatgtctcctttct
ccaccgacatggccttaaatttcggcatgatgaacaataataatagcagtaattatggagttggagacttgaatggtttt
catcagatggggagtggtctaggagctagcggtggatcgctctttactttccagcagcagacgccgtcatttccgttcat
ggccgggttggatcctacgccggcggggcttatgttcgagagcagcggagttgaggtaccggggtataatcaggtgcggc
cgagagtaccgtttgctgggatgagtatatctcaaatggcttcggtgaagatggaattagaaagtcagcagcaacaacaa
cagaatcaggagttgaatttgtcgaggcagttgttggggatgaataataattcaggaaatgatcagttctggagtaatgg
cagcggccgcggcagtggtggttctagtactactactgcatggactgatcatttggggtttaaccctacttccactacta
gcaataatattaacaatcccctataa
back to top