|
Gene Overview
Name | S-RNase |
Unique Name | HM003181.1-S-RNase |
Type | gene |
Organism | Prunus carduchorum () |
Source | genbank |
Genbank Note | ribonuclease S4; coding region not determined; contains first intron |
Alignments
The following features are aligned
Analyses
This gene is derived from or has results from the following analyses
Cross References
External references for this gene
Sequences
The
following sequences are available for this feature:
gene sequence >HM003181.1-S-RNase ID=HM003181.1-S-RNase; Name=S-RNase; organism=Prunus carduchorum; type=gene; length=418bp mcttgttcttggtttngctttcttcttgtgtttcgttatgagcactggtg atggtgggttgcattacaatcttttgctctattgcatatcatcagcattg tatttttctcttgtattttttgttcagagaaactattatgtgtgttggat gatataccacatgacatgcggtgtattgaattcgccacttataatacttt tcatttaccctagcgcacaactttctcaggatgagtaagtatatatatat tttttggtcaaggatgagtaagtatttggggattgttgttctgcattaat tttttttattttcatcctcgtttgtttattatgaaaattgttgtaataag tgcactctattcatcacaataatttttgcaggtatcttacgactatcttc aatttgtncaacantggc back to top
|