SAmsCO903298 (genetic_marker) Malus domestica | GDR

Marker Overview

Marker Overview


Name	SAmsCO903298
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	(TC) 14
Primer 1	SAmsCO903298.Forward Primer: TTGAGAAGCAATGCTGCCTC
Primer 2	SAmsCO903298.Reverse Primer: TGCCACAGTTGGAAGGTGG
Max Length	360
Publication	[view all]
Contact	Felicidad Fernandez-Fernandez

Contact

Name

Details

Felicidad Fernandez-Fernandez

First name:	Felicidad
Last name:	Fernandez-Fernandez
Title:	Researcher
Institution:	East Malling Research
Address:	East Malling Research (EMR), New Road, East Malling, Kent ME19 6BJ, UK
Country:	United Kingdoms
Email:	felicidad.fernandez@emr.ac.uk
Fax:	+44 1732 849067
Last update:	Mar 2006

Publications


Year	Publication
2012	Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2012	Fernández-Fernández F, Antanaviciute L, van Dyk MM, Tobutt KR, Evans KM, Rees DJG, Dunwell JM, Sargent DJ. A genetic linkage map of an apple rootstock progeny anchored to the Malus genome sequence. Tree genetics & genomes. 2012; 8(5):991-1002.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-GDxA-F1-consensus	LG9	N/A	34.3	SAmsCO903298	View
2	Apple-MM-F1	9	N/A	33.9	SAmsCO903298.z	View
3	Apple-M432-2012	LG9	N/A	28.7	SAmsCO903298.z	View
4	Apple-MM-F1	17	N/A	27.9	SAmsCO903298.y	View
5	Apple-M432-2012	LG17	N/A	29.8	SAmsCO903298.y	View
6	Pear-integrated_consensus_map-IPCG-2017	LG17	N/A	148.55	SAmsCO903298	View

Alignments

Feature Name	Type	Location	Analysis
Chr17	chromosome	Chr17:12634687..12635070.	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation