CH01D09, CH01D09 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	CH01D09
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	GA
PCR Condition	PCR in 15 ul total volume with 10-50 ng DNA template and 0.3 to 0.7 pM of primers combined with 1.5 unites Taq Polymerase (Promega, Madison, Wis.), 1x Promega magnesium free buffer, 0.25 mM MgCl2, adn 0.25 mM dNTP (Promega). PCR amplifications were carried out using a PTC200 thermocycler (MJ Research, Reno, Nev.). The PCR proram had an initial denaturation step of 2 min at 95C followed by 30 cycles of 30 s at 95C, 30 s at 58C, 15 s at 72 C adn ending with a final extension step of 2 min at 72C. PCR rxn were diluted 1:1 in 95% formamide, 50 mM EDTA bromophenol blue loading dye, adn denatured at 95C for 3 min.
Primer 1	CH01D09.Forward: GCCATCTGAACAGAATGTGC
Primer 2	CH01D09.Reverse: CCCTTCATTCACATTTCCAG
Product Length	134-172
Polymorphism	P_ CH01D09
Publication	[view all]
Contact	C. Gessler Miyuki Kunihisa

Contact

Name

Details

C. Gessler

First name:	Cesare
Last name:	Gessler
Institution:	ETH Zurich
Address:	ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:	Switzerland
Email:	cesare.gessler@agrl.ethz.ch
Phone:	+41 44 632 38 71
Fax:	+41 (0) 632 11 08
Last update:	May 2002

Miyuki Kunihisa

First name:	Miyuki
Last name:	Kunihisa
Institution:	NARO Institute of Fruit Tree Science
Address:	2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:	Japan
Email:	miyuky@affrc.go.jp
Phone:	81-29-838-6437
Keywords:	fruit drop

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Chr12	chromosome	Chr12:19212068..19212200 .	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	GDR marker alignment to genome using primer sequences
chr12A	chromosome	chr12A:18513638..18513784 .	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
2006	Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2006	J. Amer. Soc. Hort. Sci. 131:408-417
2002	Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014	Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-FD-F1-2006	F12	N/A	44.7	CH01d09	View
2	Apple-OA-F1-Orin	OR12	N/A	42	CH01d09	View
3	Apple-OA-F1-Akane	AK12	N/A	26.3	CH01d09	View
4	Pear-BD-F1-2014-genetic	LG12	N/A	52	CH01d09	View
5	Pear-BD-F1-2015	LG12	N/A	84.9	CH01D09	View
6	Pear-Bayuehong-F1-2015	LG12	N/A	85.56	CH01D09	View
7	Pear-Dangshansuli-F1-2015	LG12	N/A	87.2	CH01D09	View
8	Pear-integrated_consensus_map-IPCG-2017	LG12	N/A	138.47	CH01D09	View
9	Pear-Rcf-F1-female	LG12	N/A	74.66	CH01D09	View
10	Pear-M-F1-male	LG12	N/A	86.46	CH01D09	View
11	Pear-RM-F1-Integrated	LG12	N/A	81.2	CH01D09	View