Hi01a08, Hi01a08 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	Hi01a08
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	AAG-GA
PCR Condition	annealing temp 60 degree
Primer 1	Hi01a08.primer 1: AAGTCCAATCGCACTCACG
Primer 2	Hi01a08.primer 2: CGTAGCTCTCTCCCGATACG
Product Length	177-177
Polymorphism	P_ Hi01a08
Publication	[view all]
Contact	A. Patocchi Miyuki Kunihisa

Contact

Name

Details

A. Patocchi

First name:	Andrea
Last name:	Patocchi
Institution:	Agroscope Changins-W?denswil Research Station ACW
Address:	Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:	SWITZERLAND
Email:	andrea.patocchi@acw.admin.ch
Phone:	+41 44 783 6313
Fax:	+41 (0)44 783 63 05

Miyuki Kunihisa

First name:	Miyuki
Last name:	Kunihisa
Institution:	NARO Institute of Fruit Tree Science
Address:	2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:	Japan
Email:	miyuky@affrc.go.jp
Phone:	81-29-838-6437
Keywords:	fruit drop

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Chr16	chromosome	Chr16:9521568..9521752 .	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
2006	Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2014	Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-FD-F1-2006	F16	N/A	35.4	Hi01a08	View
2	Apple-OA-F1-Akane	AK16	N/A	28.3	Hi01a08	View