NH005b, NH005b (genetic_marker) Pyrus pyrifolia

Marker Overview
NameNH005b
Genbank IDN/A
TypeSSR
SpeciesPyrus pyrifolia
Repeat Motif(GA)20
PCR Condition55
Primer 1NH005b.forward primer: TGAGAAGAATTAGCCATGATGA
Primer 2NH005b.reverse primer: TTACTACTTGCGTGCGTTCC
Product Length338
Publication[view all]
ContactMiyuki Kunihisa
Toshiya Yamamoto
Contact
NameDetails
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Toshiya Yamamoto
First name:Toshiya
Last name:Yamamoto
Institution:National Institute of Fruit Tree Science, Graduate School of Life and Environmental Sciences, University of Tsukuba
Address:National Institute of Fruit Tree Science, 2-1 Fujimoto, Tsukuba, Ibaraki 305-8605, Japan
Country:Japan
Email:toshiya@affrc.go.jp
Last update:Apr 2014
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerNH005b.forward primerPyrus pyrifoliaprimer
reverse primerNH005b.reverse primerPyrus pyrifoliaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NH005bNH005bPyrus pyrifoliamarker_locus
NH005bNH005b-84.6Pyrus pyrifoliamarker_locus
NH005bNH005b-84.566Pyrus pyrifoliamarker_locus
NH005bNH005b-85.148Pyrus pyrifoliamarker_locus
NH005bNH005b-104.87Pyrus pyrifoliamarker_locus
NH005bNH005b-75.34Pyrus pyrifoliamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-OA-F1-OrinOR8N/A32NH005bView
2Apple-OA-F1-AkaneAK8N/A38.5NH005bView
3Apple-MM-F18N/A38.6NH005bView
4Pear-BH-F1Ho8N/A36.1NH005bView
5Apple-M432-2012LG8N/A26.8NH005bView
6Apple-RGxPI6-F1LG8N/A26.4NH005bView
7Pear-BD-F1-2014-geneticLG11N/A72.2NH005bView
8Pear-La_France-F1-2007La8N/A32.4NH005bView
9Pear-BD-F1-2015LG8N/A84.6NH005bView
10Pear-Bayuehong-F1-2015LG8N/A84.57NH005bView
11Pear-Dangshansuli-F1-2015LG8N/A85.15NH005bView
12Pear-integrated_consensus_map-IPCG-2017LG8N/A104.87NH005bView
13Pear-integrated_consensus_map-IPCG-2017LG11N/A75.34NH005bView