PavVRN2, PavVRN2 (genetic_marker) Prunus avium

Marker Overview
NamePavVRN2
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceCTGTGAAAATTGATATATTGAGATCTGAGGTAAGAACTTTTTTATCATCC
3' Flanking SequenceGTTTCCATTTTCCAAATCAGAAATGCAAATAATCATTGTGATAGTTTCTT
SpeciesPrunus avium
Publication[view all]
Comment'Regina' [C/T] 'Lapins' [T/T] 'Garnet' [C/T]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PavVRN2PavVRN2Prunus aviummarker_locus


Sequence
>PavVRN2 ID=PavVRN2|Name=PavVRN2|organism=Prunus avium|type=genetic_marker|length=101bp
CTGTGAAAATTGATATATTGAGATCTGAGGTAAGAACTTTTTTATCATCC
YGTTTCCATTTTCCAAATCAGAAATGCAAATAATCATTGTGATAGTTTCT
T
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-RL-F1-2015R5N/A9.38PavVRN2View