7_881892, 7_881892 (genetic_marker) Fragaria iinumae

Marker Overview
Name7_881892
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
7_8818927_881892Fragaria iinumaemarker_locus
7_8818927_881892-29.171Fragaria iinumaemarker_locus


Sequence
>7_881892 ID=7_881892|Name=7_881892|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TAAGAAAACAGAACCCTCGTGTATCAACGGCYGAGAGTCGTCCTCCTACA
AAGGTAGTAGCTAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A29.177_881892View
2Fragaria-Fii5N/A29.177_881892-29.171View