TP3896, TP3896 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP3896
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP3896TP3896Fragaria iinumaemarker_locus
TP3896TP3896-33.06Fragaria iinumaemarker_locus


Sequence
>TP3896 ID=TP3896|Name=TP3896|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCCAGCTCAGTGGCAAGGCTGGAATCACTTGAGCTTACCTCAATGG
TCACATTGAACCTC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A33.06TP3896View
2Fragaria-Fii5N/A33.06TP3896-33.06View