3_1024424, 3_1024424 (genetic_marker) Fragaria iinumae

Marker Overview
Name3_1024424
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
3_10244243_1024424Fragaria iinumaemarker_locus
3_10244243_1024424-45.196Fragaria iinumaemarker_locus


Sequence
>3_1024424 ID=3_1024424|Name=3_1024424|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TTCCATGCTTATTCCAGAAGCTGAATTTCTTRCACAGCATCCGGGACTGG
TATGCATCAATATT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A45.23_1024424View
2Fragaria-Fii5N/A45.23_1024424-45.196View