|
Marker Overview
Name | UDAp-413 |
Genbank ID | BV102509 |
Type | SSR |
Species | Prunus armeniaca |
Germplasm | Portici |
Source Type | genomic DNA |
Repeat Motif | complex |
PCR Condition | 95 C 2 min, 94 C 20 sec, 56 C 20 sec, 65 C 40 sec. 25 cycles, 65 C 7 min |
Primer 1 | UDAp-413.F primer: CCAGGACCCAAACCCTAAAA |
Primer 2 | UDAp-413.Forward Primer: CCAGGACCCAAACCCTAAAA |
Primer 3 | UDAp-413.R primer: TGCAAACACAACACCTACCTACA |
Primer 4 | UDAp-413.Reverse Primer: TGCAAACACAACACCTACCTACA |
Product Length | 179bp |
Publication | [view all] |
Contact | R. Testolin Maria Badenes
|
Publications
Year | Publication |
2004 | Messina R, Lain O, Marrazzo M, Cipriani G, Testolin R. New set of microsatellite loci isolated in apricot. Molecular ecology notes. 2004; 4(3):432-434. |
2004 | Messina R, Lain O, Marrazzo MT, Huang WG, Cipriani G, Testolin R. Isolation of microsatellites from almond and apricot genomic libraries and testing for their transportability across different Prunus species. Acta Horticulturae. 2004; 663:79-82. |
2007 | Dondini L, Lain O, Geuna F, Banfi R, Gaiotti F, Tartarini S, Bassi D, Testolin R. Development of a new SSR-based linkage map in apricot and analysis of synteny with existing Prunus maps. Tree Genetics and Genomes. 2007; 3(3):239–249. |
|