UDAp-463, UDAp-463 (genetic_marker) Prunus armeniaca

Marker Overview
NameUDAp-463
Genbank IDBV211262
TypeSSR
SpeciesPrunus armeniaca
GermplasmPortici
Source Typegenomic DNA
PCR Condition95 C 2 min, 94 C 20 sec, 56 C 20 sec, 65 C 40 sec. 25 cycles, 65 C 7 min
Primer 1UDAp-463.F primer: ATATTGCTCAAGGGGTGCTT
Primer 2UDAp-463.R primer: ACCAATCCATCTTGCAGCTC
Product Length141bp
Publication[view all]
ContactR. Testolin
Maria Badenes
Contact
NameDetails
R. Testolin
First name:Raffaele
Last name:Testolin
Institution:University of Udine, Italy
Address:Dipartimento di Scienze Agrarie e Ambientali University of Udine Via delle Scienze 208 I-33100 Udine, Italy
Country:Italy
Email:raffaele.testolin@uniud.it
Phone:0432 558632
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerUDAp-463.R primerPrunus armeniacaprimer
F primerUDAp-463.F primerPrunus armeniacaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
UDAp-463UDAp-463Prunus armeniacamarker_locus
UDAp463UDAp463Prunus armeniacamarker_locus


Germplasm
Stock NameType
Porticicultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Almond-NL-F1-2010G1N/A14.19UDAp-463View
2Apricot-LB-F1L1N/A3.2UDAp-463View
3Apricot-LL-F2-Lito-2011LG1N/A14.8UDAp-463View
4Apricot-integrated-Goldrich-2011LG1N/A13.5UDAp-463View
5Apricot-BC-F1-2016C1N/A6.1UDAp-463View
6Apricot-GC-F1-2016G1N/A0UDAp-463View
7Apricot-GC-F1-2016C1N/A2.5UDAp-463View
8Prunus Bin MapLG1N/A0UDAp-463View
9Prunus-TxE-peachV2.0LG1N/A0UDAp-463View
10Apricot-BC-F1-2016-PhenologyC1N/A7.9UDAp463View
11Apricot-GC-F1-2016-PhenologyG1N/A0UDAp463View