MEST120, MEST120 (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	MEST120
Genbank ID	AB627265
Type	EST-SSR
Species	Malus x domestica
Repeat Motif	(ag)11
Primer 1	MEST120.Forward primer: agagagctgttttcgcttgg
Primer 2	MEST120.Reverse primer: aatgctgaggcagtaatggg
Publication	[view all]
Contact	Shigeki Moriya

Contact

Name

Details

Shigeki Moriya

First name:	Shigeki
Last name:	Moriya
Title:	Researcher
Institution:	Apple Research StationNARO Institute of Fruit Tree Science
Address:	Apple Research Station, NARO Institute of Fruit Tree Science, Shimokuriyagawa, Morioka, Iwate 020-0123, Japan
Country:	Japan
Email:	moriyas@affrc.go.jp

Publications


Year	Publication
2012	Moriya S, Iwanami H, Kotoda N, Haji T, Okada K, Terakami S, Mimida N, Yamamoto T, Abe K. Aligned genetic linkage maps of apple rootstock cultivar ‘JM7’ and Malus sieboldii ‘Sanashi 63’ constructed with novel EST-SSRs. Tree genetics & genomes. 2012; 8(4):709-723.
2016	Perchepied L, Guérif P, Ravon E, Denancé C, Laurens F, Robert P, Bouvier L, Lespinasse Y, Durel CE. Polygenic inheritance of resistance to Cacopsylla pyri in a Pyrus communis × P. ussuriensis progeny is explained by three QTLs involving an epistatic interaction. Tree Genetics & Genomes. 2016 12: 108.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pear-AN-F1	LG1	N/A	29.4	MEST120	View
2	Pear-Ba-F1-2013	Ba1	N/A	19.7	MEST120	View
3	Pear-integrated_consensus_map-IPCG-2017	LG1	N/A	78.75	MEST120	View
4	Apple-JM7xS63-F1	J1	N/A	24.7	MEST120	View

Alignments

Feature Name	Type	Location	Analysis
Chr01	chromosome	Chr01:18987031..18987315.	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr1A	chromosome	chr1A:20778826..20779130.	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation